Molecular Biology Reports

, Volume 40, Issue 1, pp 417–426

Single nucleotide polymorphisms, haplotypes and combined genotypes in MYH3 gene and their associations with growth and carcass traits in Qinchuan cattle

Authors

  • Lijun Wang
    • College of Animal Science and TechnologyNorthwest A&F University
    • College of Animal Science and TechnologyNorthwest A&F University
  • Fubiao Niu
    • College of Animal Science and TechnologyNorthwest A&F University
  • Hongliang Wang
    • College of Animal Science and TechnologyNorthwest A&F University
  • Hua He
    • College of Animal Science and TechnologyNorthwest A&F University
  • Yulan Gu
    • College of Animal Science and TechnologyNorthwest A&F University
Open AccessArticle

DOI: 10.1007/s11033-012-2076-z

Cite this article as:
Wang, L., Liu, X., Niu, F. et al. Mol Biol Rep (2013) 40: 417. doi:10.1007/s11033-012-2076-z

Abstract

MYH3 is a major contractile protein which converts chemical energy into mechanical energy through the ATP hydrolysis. MYH3 is mainly expressed in the skeletal muscle in different stages especially embryonic period, and it has a role in the development of skeletal muscle and heart. In this study, polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was applied to analyze the genetic variations of the MYH3 gene and verify the effect on growth and carcass traits in a total of 365 Qinchuan cattles. The PCR product was digested with some restriction enzyme and demonstrated the polymorphism in the population, the single nucleotide polymorphisms (SNPs) at nucleotides g. +1215T>C, g. +3377C>T, and g. +28625C>T were in linkage disequilibrium with each other. The result of haplotype analysis showed that nineteen different haplotypes were identified among the five SNPs. The statistical analyses indicated that the five SNPs were significant association with growth and carcass traits (P < 0.05, N = 365); whereas the five SNPs were no significant association between 18 combined genotypes of MYH3 gene and growth and carcass traits. Taken together, our results provide the evidence that polymorphisms in MYH3 are associated with growth and carcass traits in Qinchuan cattle, and may be used as a possible candidate for marker-assisted selection and management in beef cattle breeding program.

Keywords

Qinchuan cattleGrowth and carcass traitsCombined genotypesHaplotypeMYH3

Abbreviations

PCR-RFLP

Polymerase chain reaction-restriction fragment length polymorphism

SNPs

Single nucleotide polymorphisms

MyHC

Myosin heavy chain

MYH3

Myosin heavy chain 3

HMM

Heavy meromyosin

LMM

Light meromyosin

LD

Linkage disequilibrium

He

Heterozygosity

Ho

Homozygosity

PIC

Polymorphism information content

Introduction

Multiple myosin isoforms are encoded by a multigene family and expressed in different developmental stages and fiber types. There are three skeletal fast myosin heavy chain (MyHC) genes (IIa, IIdx, and IIb), but only the promoter region of the mouse IIb gene has been analyzed to date [16]. The MyHCs encoded by a group of genes consisting of IIa, IIb [7], IIx [8], extraocular [9], embryonic [10] and neonatal [11] genes. These genes are located on the chromosome 14 [12], which expressed at different times during development and in different fiber types [1316].

Myosin proteins consist of both heavy and light chains and are present in skeletal muscle. Heavy chains are associated with the speed of muscular contractions, while the role of light chains is not well defined [17]. Studies have shown that myosin heavy chain 3 (MYH3) gene may be one of major genes implicated in the differences of muscle fiber property between intact males and castrated Qinchuan cattle [18]. The MYH3 is a major structural protein of the thick filament of the sarcomere. MYH3 gene is a member of the MYH family and encodes a protein with an IQ domain [19]. Polymorphism of MHC isoform expression in single myofibers, which points out that single fibers of both developing and adult skeletal muscle exist as hybrids [2023]. In a word, MYH3 gene is expressed during the embryonic period [24], at the same time, MYH3 has a role in skeletal muscle development [13, 25, 26].

In human, the MYH3 gene is located on chromosome 17, and it is a molecular motor that converts chemical energy into mechanical force [27]. Conventionally, class II myosin is a hexameric protein composed of two MyHC subunits, each with a molecular weight of approximately 220 kDa and two pairs of non-identical myosin light chain subunits. Proteolytic enzymes can cleave the MyHC into two sub-fragments: heavy meromyosin (HMM) and light meromyosin (LMM). The expression of MYH3 is predominated in myotubes fated to become fast myofibers and is gradually replaced by the expressions of other myosin genes (MYH1, MYH2 and MYH4) [28]. During the development and the adult, α-MYH is predominately expressed in the atrial chamber and β-MYH in the ventricular chamber in both humans and chicks [2933]. This is further illustrated by the increased expression of β-MHC in the atria of human hearts under pressure overload [34, 35]. MHC analysis of human soleus muscle shows that this muscle expresses an approximately equal mix of type I and IIa isoforms, but the type IIx MHC is not expressed [36]. In contrast, human fast muscles such as the vastus lateralis express a mix of all three types of MHC isoforms at variable proportions [36, 37], depending on the physical fitness and activity of the subject. In addition, the study shows that knockdown in the early embryo leads to abnormal atrial septal development and heart enlargement [38]. These studies all point to the potentially vital function of MYH3 in regulating gene expression at the skeletal muscle and heart development.

In a rat model, the MYH3 gene is located on chromosome 10. It is an essential protein with skeletal muscle development. β-MHC has been shown to be down-regulated in the setting of hypoxia, likely as a result of neuroendocrine stimulation [39]. Cytokines and tumor factors such as TNF-α have been demonstrated to selectively target MYH2 gene and down-regulate transcription in a mouse model [40]. MYH3 is plastic in the adult rodent heart. In contrast to described human, the adult heart of small animals such as rodents and mice mainly expresses the α-MHC throughout the adult state. These results also support the idea that MYH3 plays an important role in heart development.

In this study, we used DNA sequencing, PCR-RFLP analysis to investigate allelic variation of MYH3 gene that encompasses five SNPs. Furthermore, we reported associations among these SNPs of the MYH3 gene in the Qinchuan cattle breed and the linkage disequilibrium between the variations and we analyzed the relationship between single nucleotide polymorphisms and growth and carcass traits.

Materials and methods

Animal source and preparation of DNA samples

Cattle from the Qinchuan (QC) commercial breeds were randomly selected, for a total of 365 animals. These animals (30 ± 2 months of the age at slaughter) were reared in Shaanxi province, P.R. China. The growth traits (body length, withers height and hip width) and carcass traits (slaughter weight and carcass weight) were measured according to the criteria of GB/T17238-1998 Cutting Standard of Fresh and Chilled Beef in China (China Standard Publishing House). All experimental protocols and animal care were performed according to authorization granted by the Chinese Ministry of Agriculture. Genomic DNA was isolated from 2 % heparin-treated blood samples and stored at −80 °C, following the standard procedures [41].

PCR amplification and DNA sequencing analysis

Primers used to amplify bovine MYH3 gene were designed from a published gene sequence (GenBank accession number NC_007317). Primers, restriction enzymes selected (ABI, Foster City CA), The primer sequences, location and fragment sizes were listed in Table 1. The detection of allelic variation at the SNPs were based on the electrophoretic pattern of the restriction enzyme-treated PCR products.
Table 1

Primer sets for PCR and PCR-RFLP used for genotyping SNPs detected in bovine MYH3 gene

SNPS

Amplified region

Primer sequence (5′–3′)

AT(°C)

SAF (bp)

PR

Genotype

SNP1

Exon5

AAAGCCCGAGTATCAGAACC TCCAACAGCCTCATCAAACA

57.4

435

RSaI

CC: 228, 207

CT:228, 207, 150, 78

TT:207, 150, 78

SNP2

Intron5

AAAGCCCGAGTATCAGAACC TCCAACAGCCTCATCAAACA

57.4

435

BstXI

TT:435

TC:435, 339, 96

CC: 339, 96

SNP3

Intron7

TTGCTGCAAATGGCATTATT TGAGATTCCCAACAAAGAGG

59.8

447

PVUII

GG:447

GC:447, 222, 225

CC: 222, 225

SNP4

Exon14

TGGAGGATTTTCAGAGGGGT TGATATGGGGTGACAAGTGG

59.3

532

RSaI

CC:532

CT:532, 364, 168

TT:364, 168

SNP5

Exon14

TGGAGGATTTTCAGAGGGGT TGATATGGGGTGACAAGTGG

59.3

532

TaqI

CC:433, 99

CT:433, 243, 190, 99

TT:243, 190, 99

SNPs: single nucleotide polymorphisms; SNP1 = C1878T; SNP2 = T2010C; SNP3 = G3746C; SNP4 = C7294T; SNP5 = C7315T

AT: annealing temperature, SAF: size of amplification fragment, PR: PCR-RFLP

PCR amplifications were performed in a total volume of 15 μL, where the volume mixture contained: 50 ng of genomic DNA as template, 10 mM Tris–HCl buffer (pH 8.8), containing 50 mM KCl, 0.2 μM of each primer, 200 μM dNTP and 0.5 U Taq DNA polymerase (MBI Fermentas, USA). The Mg2+ concentration was optimized for each primer set. PCR conditions were as follows: after an initial denaturation of 5 min at 95 °C, amplicons were generated for 35 cycles of 30 s at 94 °C, 30 s at an optimal annealing temperature, and 45 s at 72 °C, followed by a 10 min final extension at 72 °C.

Restriction fragment length polymorphism analysis was used to identify the genotypes of sequence variants. The PCR products were digested in a total volume of 10 μL containing: 5 μL of PCR product, three units of restriction enzyme (0.3 μL), 1 μL of reaction buffer and 3.7 μL of ddH2O. The mixture was incubated for 10 h at specific temperature (RsaI, BstXI, PVUII and TaqI restriction enzymes were digested at 37, 55, 37 and 65 °C, respectively). Digested PCR products were mixed with 10× loading buffer and subjected to 2.5 % agarose gel electrophoresis in 1× TBE at constant voltage (110 V) for 1.0 h at room temperature. Individuals were then genotyped based on different electrophoresis patterns. Fragments displaying different PCR-RFLP patterns were purified with Qiaquick spin columns (Qiagen) and sequenced with the ABI PRISM 3730 sequencer (ABI, Foster City CA) and sequences were analyzed with BioXM software (Version 2.6). The sequences obtained were named with letters of the alphabet.

Linkage disequilibrium and statistical analysis

  1. (1)

    Genotypic frequency and allelic frequency were determined for each breed by direct counting. The formulas were as follows:

     
$$ {\text{GF}}_{\text{i}} = {\text{n}}_{\text{i}} /{\text{N AF}}_{\text{i}} = 2 {\text{Nii}} + {\text{Nij}}/ 2 {\text{N}} $$
(ni is the number of i genotypic, “Ni” is the frequency of the i allele, “N” is the number of alleles)
  1. (2)

    The pattern of pairwise linkage disequilibrium (LD) between the SNPs was measured by LD coefficient (D′) and correlation coefficient (r2), the measurements were determined using the program Haploview (http://www.broad.mit.edu/mpg/haploview) [42].

     
  2. (3)

    The χ2 test was used to determine Hardy–Weinberg equilibrium of the mutation. Population genetic indices, including heterozygosity (He), homozygosity (Ho), polymorphism information content (PIC) and effective allele numbers (Ne) were calculated according to Nei et al. [43]. The formulas were as follows:

     
$$ H_{o} = \sum\limits_{i = 1}^{n} {P_{i}^{2} } H_{e} = 1 - \sum\limits_{i = 1}^{n} {P_{i}^{2} } Ne = {1 \mathord{\left/ {\vphantom {1 {\sum\limits_{i = 1}^{n} {P_{i}^{2} } }}} \right. \kern-0pt} {\sum\limits_{i = 1}^{n} {P_{i}^{2} } }}PIC = 1 - \sum\limits_{i = 1}^{m} {P_{i}^{2} } - \sum\limits_{i = 1}^{m - 1} {\sum\limits_{j = i + 1}^{m} {2P_{i}^{2} P_{j}^{2} } } $$
(“Pi” is the frequency of the i allele, “n” is the number of alleles)
  1. (4)

    Haplotypes were obtained for each animal using the PHASE computer program (Ver 2.1) [44].

     
  2. (5)

    The SPSS software (Version 16.0) was used to analyze the association between genotypes and traits in Qinchuan cattle.

     
  3. (6)

    Combined genotypes of SNPs and growth traits association analyses were carried out to explore the possible interaction between the SNPs. The model was similar to that of single marker association analysis, except that the interaction between the two SVs was included as a fixed effect.

     

Results

Sequence variants identified of MYH3 gene

The bovine MYH3 gene located on chromosome 19, and has been revealed that it contained 42 exons and encoded 1249 amino acids. In the present study, Genomic DNA of Qinchuan breeds was successfully amplified using primer pairs for the MYH3 gene (Table 1).

In total, five variants including three exons and two introns mutation were identified in the study (Table 2). According to the information of cattle MYH3 (GenBank Accession number: NC_007317), the T2010C and G3746C mutations were in intron 5 and intron 7, respectively, while the C1878T, C7294T and C7315T mutations were in exon 5, exon 14 and exon 14, respectively. According to the sequence mutations, the PCR products could be digested with RSaI, BstXI, PVUII and TaqI restriction enzymes. Distinct banding patterns were analyzed in this study and shown in Table 2. The SNPs of g. +1878C>T and g. +7315C>T resulted in synonymous mutations of Tyr626Tyr and Val2439Val, respectively, while the SNP of g. +7294C>T brought a missense mutation Arg2432Cys. Interestingly, it was firstly found that five novel mutations could be detected by endonucleases restriction site in bovine MYH3 gene.
Table 2

Description of the SNPs at the bovine MYH3 gene

SNPs name

Alleles

Amino acid change

SNP1 C1878T

TAC/TAT

Tyr626Tyr

SNP2 T2010C

TGT/TGC

SNP3 G3746C

TGT/TCT

SNP4 C7294T

CGT/TGT

Arg2432Cys

SNP5 C7315T

CGA/TGA

Val2439Val

Note: SNPs: single nucleotide polymorphisms; SNP1 = C1878T; SNP2 = T2010C; SNP3 = G3746C; SNP4 = C7294T; SNP5 = C7315T

It was a very useful strategy to scan large sample size sequence mutations with the methods of DNA sequencing and PCR-RFLP, which would overcome the inaccuracy, the complicated technical demands, slow speed and unstable reproducibility. Interestingly, in this study, the PCR-RFLP method was successfully carried out to accurately detect the polymorphisms of the MYH3 gene.

At the SNP1-RSaI locus, digestion of the 435 bp PCR fragment of MYH3 exon 5 with RSaI resulted in fragment lengths of 228, 207, 150 and 78 bp for genotype CT; 228, 207, 150 and 78 bp for genotype TT and 228 and 207 bp for genotype CC (see Fig. 1). The frequencies of genotype and allele were calculated in the Qinchuan bovine population (Table 2). The frequency of allele T was dominant in the Qinchuan cattles and CT genotype was more frequent than other genotypes. The genotypic frequencies of SNP1-RSaI locus in Qinchuan cattle population agreed with Hardy–Weinberg disequilibrium (0.01 < P < 0.05) (Table 3).
https://static-content.springer.com/image/art%3A10.1007%2Fs11033-012-2076-z/MediaObjects/11033_2012_2076_Fig1_HTML.gif
Fig. 1

The 3 % agarose gels electrophoretic patterns of the MYH3 gene in bovine. M = DNA molecular weight marker is Marker I; C1878T genotype: CC = 228 + 207 bp, TT = 207 + 150 + 78 bp, CT = 228 + 207 + 150 + 78 bp; It is difficult to see the 78 bp DNA fragment on 3 % agarose gel. Forced PCR-RFLP detection results of MYH3 gene PCR product

Table 3

Genotypic and allelic frequencies (%), value of χ2 test and diversity parameter of bovine MYH3 gene

SNPs

Genotype

Number

GF

Allele

AF

χ2(HWE)e

He

HO

Ne

PIC

SNP1

CC

51

0.1397

C

0.4205

     

CT

205

0.5616

T

0.5795

8.4758

0.4874

0.5126

1.9508

0.3686

TT

109

0.2986

       

SNP2

TT

56

0.1534

T

0.4233

     

TC

197

0.5397

C

0.5767

4.0605

0.4882

0.5118

1.9539

0.3690

CC

112

0.3068

       

SNP3

GG

43

0.1178

G

0.4384

     

GC

234

0.6411

C

0.5616

33.2854

0.4924

0.5076

1.9701

0.3712

CC

88

0.2411

       

SNP4

CC

39

0.1068

C

0.4068

     

CT

219

0.6000

T

0.5932

21.5790

0.4826

0.5174

1.9327

0.3661

TT

107

0.2932

       

SNP5

CC

46

0.1260

C

0.4123

     

CT

209

0.5726

T

0.5877

12.0281

0.4846

0.5154

1.9402

0.3672

TT

110

0.3014

       

Note: SNPs: single nucleotide polymorphisms; SNP1 = C1878T; SNP2 = T2010C; SNP3 = G3746C; SNP4 = C7294T; SNP5 = C7315T

Number: genotype number

GF: genotypic frequency; AF: allelic frequency; χ2(HWE): Hardy–Weinberg equilibrium χ2 value; He: gene heterozygosity; Ho: gene homozygosity; Ne: effective allele numbers; PIC: polymorphism information content

At the SNP2-BstXI locus, digestion of the 435 bp PCR fragment with BstXI resulted in fragment lengths of 435 bp for genotype TT; 435, 339 and 96 bp for genotype TC and 339 and 96 bp for genotype CC (see Fig. 2). The frequency of allele C was dominant in the Qinchuan breeds and TC genotype was more frequent than other genotypes. The genotypic frequencies of SNP2-BstXI locus in Qinchuan cattle population agreed with Hardy–Weinberg equilibrium (P > 0.05) (Table 3).
https://static-content.springer.com/image/art%3A10.1007%2Fs11033-012-2076-z/MediaObjects/11033_2012_2076_Fig2_HTML.gif
Fig. 2

The 3 % agarose gels electrophoretic patterns of the MYH3 gene in bovine. M = DNA molecular weight marker is Marker I; T2010C genotype: TT = 435 bp, TC = 435 + 339 + 96 bp, CC = 339 + 96 bp; It is difficult to see the 96 bp DNA fragment on 3 % agarose gel

At the SNP3-PVUII locus, digestion of the 447 bp PCR fragment with PVUII resulted in fragment lengths of 447 bp for genotype GG; 447, 225 and 222 bp for genotype GC and 225 and 222 bp for genotype CC (see Fig. 3). The frequency of allele C was dominant in the Qinchuan breeds and GC genotype was more frequent than other genotypes. The genotypic frequencies of SNP3-PVUII locus in Qinchuan cattle population agreed with Hardy–Weinberg disequilibrium (P < 0.01) (Table 3).
https://static-content.springer.com/image/art%3A10.1007%2Fs11033-012-2076-z/MediaObjects/11033_2012_2076_Fig3_HTML.gif
Fig. 3

The 2.5 % agarose gels electrophoretic patterns of the MYH3 gene in bovine. M = DNA molecular weight marker is Marker I; G3746C genotype: GG = 447 bp, GC = 447 + 225 + 222 bp, CC = 225 + 222 bp; It is difficult to see the 222 bp and 225 bp DNA fragment on 2.5 % agarose gel

At the SNP4-RSaI locus, digestion of the 532 bp PCR fragment with RSaI resulted in fragment lengths of 532 bp for genotype CC; 532, 364 and 168 bp for genotype CT and 364 and 168 bp for genotype TT (see Fig. 4). The frequency of allele T was dominant in the Qinchuan breeds and CT genotype was more frequent than other genotypes. The genotypic frequencies of SNP4-RSaI locus in Qinchuan cattle population agreed with Hardy–Weinberg disequilibrium (P < 0.01) (Table 3).
https://static-content.springer.com/image/art%3A10.1007%2Fs11033-012-2076-z/MediaObjects/11033_2012_2076_Fig4_HTML.gif
Fig. 4

The 2.5 % agarose gels electrophoretic patterns of the MYH3 gene in bovine. M = DNA molecular weight marker is Marker I; C7294T genotype: CC = 532 bp, CT = 532 + 364 + 168 bp, TT = 364 + 168 bp; It is difficult to see the 168 bp DNA fragment on 2.5 % agarose gel

At the SNP5-TaqI locus, digestion of the 433 bp PCR fragment with TaqI resulted in fragment lengths of 433 bp for genotype CC; 433, 243 and 190 bp for genotype CT and 243 and 190 bp for genotype TT (see Fig. 5). The frequency of allele T was dominant in the Qinchuan and CT genotype was more frequent than other genotypes. The genotypic frequencies of SNP5-TaqI locus in Qinchuan cattle population agreed with Hardy–Weinberg disequilibrium (P < 0.01) (Table 3).
https://static-content.springer.com/image/art%3A10.1007%2Fs11033-012-2076-z/MediaObjects/11033_2012_2076_Fig5_HTML.gif
Fig. 5

The 3 % agarose gels electrophoretic patterns of the MYH3 gene in bovine. M = DNA molecular weight marker is MarkerI; C7315T genotype: CC = 433 + 99 bp, CT = 243 + 190 + 99 bp, TT = 433 + 243 + 190 + 99 bp

Analysis of polymorphism of the MYH3 in Qinchuan cattle population

The means and standard deviations (SD) for traits were analyzed in this study shown in Table 4. The allelic and genotypic frequencies, genetic diversity parameters (Ho, He, Ne and PIC) of the five SNPs were shown in Table 3. According to Table 3, only one loci of Qinchuan cattle was in Hardy–Weinberg equilibrium (P > 0.05). It showed that the Qinchuan cattle breed was in a dynamic disequilibrium in artificial selection, migration and genetic drift function. The maximum and minimum PIC values were 0.3661 and 0.3690. According to the genetic diversity classification of PIC (PIC value <0.25, low polymorphism; 0.25 < PIC value < 0.5, intermediate polymorphism and PIC value >0.5, high polymorphism), at the five SNPs, the result reflected that an intermediate genetic diversity of Qinchuan bovine MYH3 gene in the population analyzed.
Table 4

Means and standard deviations (SD) for traits

Traits

Mean

SD

Body height (cm)

140.22

4.26

Withers length (cm)

150.71

6.14

Hip width (cm)

48.00

3.66

Slaughter weight (kg)

497.96

63.67

Carcass weight (kg)

268.87

36.99

Linkage disequilibrium and haplotype analysis of the MYH3 in Qinchuan cattle population

Linkage disequilibrium and haplotype analysis of the MYH3 gene in Qinchuan cattle population were shown in Tables 5 and 6. The linkage disequilibrium between the five SNPs in the population was estimated, which indicated that the D′ values ranged from 0.011 to 0.58; the r2 values were from 0.000 to 0.292. Moreover, SNP1 and SNP2–SNP5 had little linkage equilibrium (D′ < 0.07 and r2 < 0.003). SNP2 and SNP3–SNP5 had little linkage equilibrium (D′ < 0.08 and r2 < 0.003).
Table 5

The estimated values of linkage equilibrium analysis between 5 mutation sites within MYH3 gene of studied population

SNPs

1

2

3

4

5

1

 

D′ = 0.077

D′ = 0.080

D′ = 0.026

D′ = 0.011

2

r2 = 0.003

 

D′ = 0.087

D′ = 0.080

D′ = 0.110

3

r2 = 0.002

r2 = 0.003

 

D′ = 0.439

D′ = 0.580

4

r2 = 0.001

r2 = 0.004

r2 = 0.110

 

D′ = 0.422

5

r2 = 0.000

r2 = 0.005

r2 = 0.292

r2 = 0.117

 

SNPs single nucleotide polymorphisms; 1 = C1878T; 2 = T2010C; 3 = G3746C; 4 = C7294T; 5 = C7315T

D′ and r2 above and below the diagonal, respectively

Table 6

Haplotype and haplotype frequency within studied population of 3 SNPs in bovine MYH3 gene

Haplotype

SNPs

Frequency in population

Cumulative frequency

 

G3746C

C7294T

C7315T

  

Hap 1

C

C

C

0.080

0.080

Hap 2

C

C

T

0.149

0.229

Hap 3

C

T

C

0.046

0.275

Hap 4

C

T

T

0.393

0.668

Hap 5

G

C

C

0.210

0.878

Hap 6

G

C

T

0.038

0.916

Hap 7

G

T

C

0.034

0.950

Hap 8

G

T

T

0.050

1.000

The haplotype analysis showed that eight different haplotypes were identified among the three SNPs. Three major haplotypes accounting for 75.2 % of the alleles were obtained as follows, haplotype 2: –CCT– (14.9 %), haplotype 4, –CTT– (39.3 %) and haplotype 5, –GCC– (21.0 %).

Association analysis of single markers and combined genotypes

The results of the association analyses between five mutations in MYH3 and growth and carcass traits were shown in Table 7. Growth and carcass traits were associated by the analysis of Qinchuan cattle at 30 ± 2 months old. According to Table 7, at locus C1878T, the animals with the CT genotype had greater withers height and heavier slaughter weight than those with the TT genotype (P < 0.05). At locus T2010C, the TT genotype was better than the TC and CC genotypes, and the animals with the TT genotype had greater withers height than those with the CC genotype (P < 0.05), the animals with the TT genotype had heavier slaughter weight than those with the TC and CC genotypes (P < 0.05). At locus G3746C, the animals with the GG genotype had greater body length and withers height than those with the GC and CC genotypes (P < 0.05), and GG genotype had greater hip width than those with GC genotype (P < 0.05). At locus C7315T, the animals with the CC genotype had heavier slaughter weight than those with CT genotype (P < 0.05). The rest of the records of growth and carcass traits had no significant association (P > 0.05).
Table 7

Association of SNPs with growth and carcass traits

Locus

Genotype

N

Body length (cm) (mean ± SE)

Withers height (cm) (mean ± SE)

Hip width (cm) (mean ± SE)

Slaughter weight (kg) (mean ± SE)

Carcass weight (kg) (mean ± SE)

C1878T

CC

51

140.681 ± 0.882

151.306 ± 0.991ab

47.292 ± 0.622

497.056 ± 10.171ab

265.425 ± 5.656

CT

205

140.382 ± 0.524

150.382 ± 0.589b

46.750 ± 0.370

495.824 ± 6.043b

266.104 ± 3.360

TT

109

140.753 ± 0.603

152.506 ± 0.678a

47.299 ± 0.425

505.623 ± 6.955a

273.209 ± 3.868

P

 

0.889

0.063

0.564

0.049

0.321

T2010C

TT

56

140.568 ± 0.777

149.676 ± 0.947b

46.676 ± 0.573

487.243 ± 9.266

258.881 ± 5.260b

TC

197

140.055 ± 0.637

150.855 ± 0.777ab

47.491 ± 0.470

497.036 ± 7.600

268.102 ± 4.314a

CC

112

141.206 ± 0.811

152.735 ± 0.988a

46.941 ± 0.598

509.706 ± 9.666

265.806 ± 5.487a

P

 

0.536

0.043

0.521

0.248

0.032

G3746C

GG

43

138.629 ± 0.940b

148.742 ± 1.065b

45.758 ± 0.666b

484.290 ± 10.908

264.461 ± 6.115

GC

234

140.964 ± 0.575a

151.892 ± 0.651a

47.301 ± 0.407a

507.000 ± 6.667

271.022 ± 3.737

CC

88

140.832 ± 0.521a

151.594 ± 0.590a

47.213 ± 0.369ab

498.089 ± 6.043

267.742 ± 3.388

P

 

0.085

0.035

0.117

0.198

0.625

C7294T

CC

39

140.353 ± 0.680

151.138 ± 0.782

46.914 ± 0.494

492.552 ± 7.986

266.414 ± 4.518

CT

219

140.146 ± 0.572

150.524 ± 0.658

47.067 ± 0.416

500.061 ± 6.716

271.487 ± 3.800

TT

107

141.308 ± 0.643

152.123 ± 0.739

47.146 ± 0.467

501.539 ± 7.544

267.275 ± 4.268

P

 

0.376

0.272

0.942

0.681

0.637

C7315T

CC

46

140.283 ± 0.964

149.700 ± 1.094

46.467 ± 0.681

485.100 ± 11.141b

268.123 ± 6.243

CT

209

140.112 ± 0.533

151.837 ± 0.605

47.026 ± 0.377

504.102 ± 6.164a

268.125 ± 3.454

TT

110

141.14 ± 0.569

151.198 ± 0.646

47.192 ± 0.402

499.372 ± 6.580ab

269.176 ± 3.687

P

 

0.404

0.231

0.657

0.030

0.976

Note: Values with different superscripts within the same column differ significantly at P < 0.05 (a, b)

SE standard error

S
The combined genotypes association results for SNP3, SNP4 and SNP5 were shown in Table 8. The associated analysis suggested that no significant differences were detected between the combined genotypes of three SNPs and growth and carcass traits in Qinchuan cattle (P > 0.05).
Table 8

Associations between combined genotypes of three SNPs and growth and carcass traits in Qinchuan cattle (N = 365): Mean ± SE

Genotype of combination (19)

Number of combination

Body length (cm) (mean ± SE)

Withers height (cm) (mean ± SE)

Hip width (cm) (mean ± SE)

Slaughter weight (kg) (mean ± SE)

Carcass weight (kg) (mean ± SE)

1 CCCCCC

7

139.33 ± 3.09

150.67 ± 3.49

48.33 ± 2.18

467.33 ± 36.02

283.73 ± 19.78

2 CCCCCT

15

140.29 ± 2.03

152.29 ± 2.29

46.43 ± 1.43

515.14 ± 23.58

259.40 ± 12.95

3 CCCCTT

8

137.50 ± 3.79

153.00 ± 4.28

45.50 ± 2.68

496.00 ± 44.11

264.10 ± 24.22

4 CCCTCC

8

145.00 ± 3.79

152.50 ± 4.28

47.00 ± 2.68

524.00 ± 44.11

255.90 ± 24.22

5 CCCTCT

25

140.13 ± 1.38

151.40 ± 1.56

47.57 ± 0.98

490.80 ± 16.11

263.33 ± 8.85

6 CCCTTT

40

141.00 ± 1.05

150.81 ± 1.19

46.73 ± 0.74

498.31 ± 12.23

271.83 ± 6.72

7 CCTTCC

6

142.00 ± 3.79

152.00 ± 4.28

47.50 ± 2.68

503.50 ± 44.11

285.10 ± 24.22

8 CCTTCT

16

139.67 ± 1.79

153.33 ± 2.02

46.90 ± 1.26

490.11 ± 20.79

270.44 ± 11.42

9 CCTTTT

50

141.30 ± 0.88

151.68 ± 0.99

47.65 ± 0.66

501.70 ± 10.26

266.39 ± 5.63

10 GCCCCC

10

140.50 ± 2.68

147.75 ± 3.02

45.75 ± 1.89

463.50 ± 31.19

264.75 ± 17.13

11 GCCCCT

28

141.80 ± 1.20

153.95 ± 1.35

48.45 ± 0.85

503.25 ± 13.95

264.54 ± 7.66

12 GCCTCT

40

140.07 ± 1.03

151.78 ± 1.16

47.37 ± 0.73

520.41 ± 12.01

279.10 ± 6.59

13 GCCTTT

22

140.73 ± 1.62

150.09 ± 1.82

47.00 ± 1.14

485.82 ± 18.81

265.65 ± 10.33

14 GCTTCT

15

141.40 ± 1.70

152.40 ± 1.91

45.80 ± 1.20

512.60 ± 19.73

263.54 ± 10.83

15 GCTTTT

11

141.88 ± 1.90

150.75 ± 2.14

47.38 ± 1.34

511.25 ± 22.06

266.58 ± 12.11

16 GGCCCC

25

139.79 ± 1.30

149.18 ± 1.47

46.53 ± 0.91

483.76 ± 15.13

265.93 ± 8.31

17 GGCCCT

9

136.40 ± 2.40

148.20 ± 2.71

44.00 ± 1.69

479.20 ± 27.90

258.28 ± 15.32

18 GGCTCT

10

136.67 ± 2.19

146.00 ± 2.47

45.67 ± 1.54

480.83 ± 25.47

264.87 ± 13.99

19 GGTTCC

5

139.00 ± 3.79

151.50 ± 4.28

43.00 ± 2.68

509.00 ± 44.11

265.35 ± 24.22

Significance (P value)

 

0.83

0.59

0.75

0.93

0.99

SE standard error

Discussion

In previous studies, the MYH3 gene is the majority myosin isoform in embryonic and neonatal muscle fibers and its expression declines after birth to become undetectable around 3 weeks postnatal [45]. MYH3 expression demonstrates in the early looping heart, and subsequently throughout the myocardium of the outflow tract, and at lower levels to the ventricular chamber [38]. Knockdown of MYH3 in the chick resulted in abnormal atrial septal development, similar to that seen upon α-MYH knockdown [46, 47]. These results support the idea that MYH3 is a fundamental process in skeletal muscle and heart development. Another study finds that myosin myopathies have evolved as a new group of muscle diseases caused by mutations in skeletal muscle myosin heavy-chain genes [48].

Up to now, there are few polymorphisms detected in the MYH3 gene, it may be related to meat quality traits. We choosed it as a candidate gene to identify its SNPs and analyze the associations between the polymorphism and growth and carcass traits in the Qinchuan cattle population, which would lay the foundation for the study on the function of MYH3 gene in the cattle breed.

The allelic and genotypic frequencies, PIC, He, Ne and χ2 values for SNPs showed considerable variability in Qinchuan cattle, the allelic frequency of the T alleles in five loci were up to 0.42 and C alleles in five loci were up to 0.40. PIC, He and Ne of SNP3 were higher than other four SNPs, showed the high polymorphism, high genetic variability, high ability to maintain allelic stability during selection or mutation, so SNP3 was likely to be useful in breeding programs for Qinchuan cattle. Chi-squared tests of SNP1, SNP3, SNP4 and SNP5 did not agreed with Hardy–Weinberg equilibrium (0.01 < P < 0.05, P < 0.01, P < 0.01 and P < 0.01, respectively), while SNP2 met with the Hardy–Weinberg equilibrium (P > 0.05).

In this study, we first reported the novel five SNPs in bovine MYH3 gene, and its association analysis with the growth and carcass traits in bovine. The genotypes at locus C1878T had a significant effect on slaughter weight. The genotypes at locus T2010C had a significant effect on withers height and carcass weight. The genotypes at locus G3746C had a significant effect on withers height. The genotypes at locus C7315T had a significant effect on slaughter weight. Based on these study, the individuals with better performance with the CT genotype at locus C1878T and TT genotypes at locus T2010C and GG genotypes at locus G3746C and CC genotypes at locus C7315T could be used for the development of new breeds of beef cattle in China, and these four locus could be used as remarkable molecular markers for better performance in the bovine industry.

The result of haplotype analysis of three major loci showed that eight different haplotypes were identified which get nineteen combined haplotypes, and all nineteen combined genotypes were found in this study animal DNA samples, four major combined haplotypes accounting for 51.9 % of the haplotypes were obtained as follows, CCCTTT: (12.3 %), CCTTTT: (17.5 %), GCCTCT: (9.4 %), GCCCCT: (12.7 %). But the associated analysis suggested that no significant differences were detected between the combined genotypes of three SNPs and growth and carcass traits in Qinchuan cattle (P > 0.05). So this study indicated that combined haplotypes did not increase growth or carcass traits of Qinchuan cattle.

In our study, three mutations in the bovine MYH3 gene were found in the exon region, polymorphisms in these regions could alter gene expression. The SNP g. +7294C>T was a missense mutation Arg2432Cys. It is possible to change the important physiological function in secondary and tertiary configuration of MYH3 protein as well as affect the biological function of protein, and it needs to study further. Our study was the first report of five novel SNPs in the bovine MYH3 gene, and we analyzed their association with growth and carcass traits in Qinchuan cattle. The results showed that some genotypes had a significant effect on the growth and carcass traits. Therefore, these mutations of MYH3 gene might positively influence the growth and carcass traits in Qinchuan population. In conclusion, this study will be contributed to geneticists and breeders as a molecular marker for better performance in the bovine industry. While the further research is still needed to clarify the role on the genetic variants of the MYH3 gene, and to analyze the mRNA expression levels of the MYH3 gene. Hence, would be a candidate gene worthy of further investigation.

Acknowledgments

Research supported by the 12th “Five-Year” National Science and Technology Key Project (No. 2011AA100307), the National “863” Program of China (No. 2008AA101010), “13115” Sci-Tech Innovation Program of Shaanxi Province (No. 2008ZDKG-11).

Open Access

This article is distributed under the terms of the Creative Commons Attribution License which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited.

Copyright information

© The Author(s) 2012