Molecular Biology Reports

, Volume 38, Issue 6, pp 3751–3756

Molecular cloning and expression analysis of a F-type lectin gene from Japanese sea perch (Lateolabrax japonicus)

Authors

  • Lihua Qiu
    • Biotechnology and Aquiculture LaboratoryThe South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences
  • Liansheng Lin
    • Chinese Academy of Fishery Sciences
  • Keng Yang
    • Biotechnology and Aquiculture LaboratoryThe South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences
  • Hanhua Zhang
    • Biotechnology and Aquiculture LaboratoryThe South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences
  • Jianzhu Li
    • Biotechnology and Aquiculture LaboratoryThe South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences
  • Falin Zou
    • Biotechnology and Aquiculture LaboratoryThe South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences
    • Biotechnology and Aquiculture LaboratoryThe South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences
Article

DOI: 10.1007/s11033-010-0490-7

Cite this article as:
Qiu, L., Lin, L., Yang, K. et al. Mol Biol Rep (2011) 38: 3751. doi:10.1007/s11033-010-0490-7

Abstract

The techniques of homology cloning and anchored PCR were used to clone the fucose-binding lectin (F-type lectin) gene from Japanese sea perch (Lateolabrax Japonicus). The full-length cDNA of sea perch F-lectin (JspFL) contained a 5′ untranslated region (UTR) of 39 bp, an ORF of 933 bp encoding a polypeptide of 310 amino acids with an estimated molecular mass of 10.82 kDa and a 3′ UTR of 332 bp. The searches for nucleotides and protein sequence similarities with BLAST analysis indicated that the deduced amino acid sequence of JspFL was homological to the Fucose-binding lectin in other fish species. In the JspFL deduced amino acid sequence, two tandem domains that exhibit the eel carbohydrate-recognition sequence motif were found. The temporal expressions of gene in the different tissues were measured by real-time PCR. And the mRNA expressions of the gene were constitutively expressed in tissues including spleen, head-kidney, liver, gill, and heart. The JspFL expression in spleen was different during the stimulated time point, 2 h later the expression level became up-regulated, and 6 h later the expression level became down-regulated. The result indicated that JspFL was constitutive and inducible expressed and could play a critical role in the host-pathogen interaction.

Keywords

F-type lectinCloningExpressionJapanese sea perch

Introduction

Marine fish aquaculture is a big industry and plays an important role in the economic development of coastal provinces in China. Lateolabrax japonicus is one of the most important marine fish species cultivated widely in the southern and northern coastal provinces in China. It was mainly used as export commodities. Since the summer of 2004, large-scale deaths of L. japonicus in china have caused catastrophic losses to marine fish aquaculture and export. It is still unclear which pathogens are responsible for the marine fish mortality, but understanding the immune response of marine fish to pathogens will provide a better understanding of the immune defense mechanisms of fish and ultimately may lead to the development of better disease management strategies in fish farming.

Innate immunity is a key component of disease resistance in vertebrates. Instead of relying on antibodies for pathogen recognition, innate immunity consists largely of pattern based recognition of non-self cells, often through the arrangement of carbohydrates on their surfaces. In mammals, the proteins that recognize these carbohydrates are soluble lectins known to play key roles in the innate immune system and to affect overall disease resistance. These lectins would be expected to play an equal or greater role in fish, in which acquired (i.e., antibody-mediated) immunity is more variable [1].

Lectins are proteins that specifically bind to carbohydrate structures without being enzymes or immunoglobulins [2] and are widely distributed in both the plant and the animal kingdom. Their biological role includes fertilization, morphogenesis and defence against micro-organisms, including phagocytosis [3], complement activation [4] and enhancement of natural killer cell activity [5]. Although the biological functions of lectins in plants are generally unclear, they are very diverse and have been well studied [6]. According to the sequence comparison of the CRD (carbonhydrate recognition domain), lectins can be divided into at least six families: legume lectins, cereal lectins, P-, S-, C-type lectins, and pentraxins [7, 8].

Recently, a novel lectin (fucose lectin) family was proposed by Honda et al. [9] who identified a calcium-independent, non-glycosylated lectin in the eel and it was characterized by a unique CRD sequence motif and structural fold. The described structure of the fucose-binding European eel agglutinin (AAA) [9] revealed that a lectin fold (the “F-type” fold) was widely distributed in proteins from prokaryotes and eukaryotes, including invertebrates and vertebrates, with some representatives proposed to play a role in immunity [10, 11]. The F-type fold is also shared with several proteins of distinct functional properties, including the C-terminal domain of human blood coagulation factors V [12] and VIII [13], the C-terminal domain of bacterial sialidases [14], the N-terminal domain of a fungal galactose oxidase [15], a human ubiquitin ligase subunit, a domain of the single-strand DNA break repair complex, the β1 domain of neuropilin [16], and the yeast allantoicase [17]. The structural analogy of these seemingly unrelated proteins is indicative of the archaic origin of this lectin fold.

With the development of the technique of gene cloning, molecular techniques have recently enabled the identification of fish lectin genes and other immune genes [1820]. Till now, the molecular structure of the F-binding lectin has been determined in several fish, including rainbow trout (Oncorhynchus mykiss) [21], sea bass (Dicentrarchus labrax) [22], striped bass (Morone saxatilis) [23].

The main objectives of this study are (1) to clone the full-length cDNA of F-lectin from Japanese sea perch and compare it to other known F-lectin genes to prove the existence of F-lectin in sea perch, (2) to investigate the expression pattern of gene after the fish was challenged by pathogens, and (3) to discuss the putative role of F-lectin in the immune responses in fish.

Materials and methods

Animals and immune challenge

Fifty healthy locking Japanese sea perch (L. japonicus) weighing about 100–200 g were purchased from Guangzhou, Guangdong province, P. R. China. The fish were maintained in the aerated seawater (salinity 30) for 3 days at 24–25°C, then were used in the following examination. For gene cloning including homology cloning and RACE, three fish each weighing about 200 g were injected with 200 μl LPS (10 μg ml−1, resuspended into the water) in the muscle respectively 6 h prior to the RNA was isolated from the spleen. For gene expression, (1) three fish were cultivated without any stimulation prior to the RNA was isolated from the tissues including spleen, head kidney, heart, liver and gill. (2) 100 μl LPS (10 μg ml−1, resuspended into the water) were injected into the muscles of each fish as the stimulated group. The untreated fish and fish injected with 100 μl water were used as the blank and the control group, respectively. The injected fish were returned to seawater tanks numbered control and stimulation, respectively. Three individuals from the blank, control, and stimulated group, respectively, were randomly collected at 2, 4, 6, 8, 10, 16, and 24 h post-injection prior to the RNA was isolated from the spleen.

Total RNA isolation

Total RNA was isolated from the tissues (weight about 50 mg) of the fishes using Trizol (Invitrogen, Japan) reagent following the protocol of the manufacturer, and resuspended in DEPC-treated water and stored at −80°C.

Synthesis of the cDNA first strand

cDNA was synthesized from 2 μg of mRNA by Moloney Murine Leukemia Virus reverse transcriptase (M-MLV, Promega, USA) at 42°C for 50 min with oligo-dT-adaptor primer (GGCCACGCGACTAGTAC(T)16) following the protocol of the manufacturer.

Gene cloning and sequencing

Initially, PCR was performed using the cDNA prepared above as template, with the degenerated primers of Fe (ATGAHGAAAWTCAGTGTRTTC) and Re (CTAAHCCAGGAC WGAGCCAT) designed according to the conserved regions of other known F-type lectin sequences, in order to obtain the partial fragment of gene from sea perch. The obtained PCR products were separated by 1.5% agarose gel, and then purified by PCR purification kit. The purified PCR product was ligated with the PMD18-T vector (TaKaRa, Japan), and transformed into the competent Escherichia coli cells. The recombinants were identified through blue–white color selection and screened with M13 forward and reverse primers. Three of the positive clones were sequenced on an ABI3730 Automated Sequencer (Applied Biosystem). Sequences generated were analyzed for similarity with other known sequences using the BLAST programs (http://www.ncbi.nim.nih.gov/).

Having isolated a partial JspFL sequence, the 5′ and 3′ ends of mRNA were obtained by rapid amplification of cDNA ends (RACE) methods, using gene-specific primers shown. In 3′ RACE-PCR, PCR reaction was performed with primer F1 (CAGGAAGAGAAGAGTTCCTG) and adaptor primer (GGCCACGCGACTAGTAC). In 5′ RACE-PCR, the first strand cDNA obtained was tailed with poly (C) at the 5′ ends using terminal deoxynucleotidyl transferase (TdT, Takara, Japan). PCR was performed initially with primer R1 (TGCATGATCCAG AGTGGAAG) and Oligo-dG (GGGGGGGGGGGGGGGH). The PCR products were gel-purified and sequenced, then the resulted sequences were subjected to cluster analyzed.

Generated sequences were analyzed for similarity with other known sequences using the BLAST program (http://www.ncbi.nlm.nih.gov/BLAST/). Multiple sequence alignments were performed using the CLUSTAL W program at the European Bioinformatics Institute (http://www.ebi.ac.uk). Analyses of the deduced amino acid sequences utilized the programs PSORT (Kenta Nakai, National Institute Basic Biology), Scan Prosite (EXPASy Molecular Biology Server), and Predict Protein (EMBL-Heidelberg).

Quantification of JspFL expression by quantitative real-time PCR

Real-time quantitative PCR was performed with the SYBR Green 2× Supermix (Applied Biosystems, USA) on an ABI 7300 Real-Time Detection System (Applied Biosystems, USA) to investigate the expression of JspFL. Two specific primers, rF (TGACTTTGGTT CTGCCTG GTT) and rR (GGACTGTGTGGCTTTTCCTTG) were used to amplify a PCR product of 108 bp. β-actin was chosen as the reference gene for internal standardization. Two β-actin primers β-actin rF (CAACTGGGATGACATGGAGAAG) and β-actin rR (TTGGCTTTGGGGTTCAGG) were used to amplify a β-actin gene fragment of 110 bp as the internal control for qRT-PCR. The qRT-PCR amplifications were carried out in triplicates in a total volume of 20 μl containing 10 μl of 2× Supermix (Applied Biosystems, USA), 5 μl of the 1:5 diluted cDNA, 1 μl each of forward and reverse primer and 3 μl PCR grade water, The qRT-PCR program was 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of 94°C for 15 s, 61°C for 30 s, 72°C30 s. Melting curve analysis of amplification products was performed at the end of each PCR reaction to confirm that only one PCR product was amplified and detected. After the PCR program, qRT-PCR data from three replicate samples were analyzed with a 7300 System SDS Software v1.3.0 (Applied Biosystems, USA) to estimate transcript copy numbers for each sample. To maintain consistency, the baseline was set automatically by the software. The comparative CT method was used to analysis the expression level of JspFL. The CT for the target amplification of FBL and the CT for the internal control β-actin were determined for each sample. Differences between the CT for the target and the internal control, called CT, were calculated to normalize the differences in the amount of total nucleic acid added to each reaction and the efficiency of the RT-PCR. The blank group was used as the reference sample, called the calibrator. The CT for each sample was subtracted from the CT of the calibrator; the difference was called ∆∆CT value. The expression level of JspFL could be calculated by 2−∆∆CT, and the value stood for an n-fold difference relative to the calibrator. The average cycle threshold (CT) measurement for the three determinations were used in calculations of relative expression using β-actin as the internal control. The data obtained from RT-PCR analysis were subjected to one-way analysis of variance (one-way ANOVA) followed by an unpaired, two-tailed t-test. Differences were considered significant at P < 0.05.

Results

Cloning and sequence of JspFL gene

Three overlapping products were obtained by RT-PCR amplification, which comprised the full-length cDNA. The sequence consisted of 1304 nucleotides including a 930 bp single open reading frame (ORF), a 39 bp 5′ untranslated region (5′ UTR) and a 332 bp 3′ UTR. In the 3′ UTR, there were a 21 bp poly (A) tail and a putative polyadenylation signal which located 21 bp upstream of the poly (A) tail. The open reading frame encoded a 310 amino acids precursor peptide with a molecular weight about 10.82 kDa, and theoretical point of 5.02. The complete nucleotide sequence of cDNA and the deduced amino acid sequence of JspFL are shown in GenBank and the accession No. is DQ855621. The mature protein sequence encoded has a length of 292 residues. The cleavage site of the 18-residue signal sequence was predicted by the SignalP algorithm to reside between Ala18 and Ser19. Sequence comparison to AAA [10] revealed the presence of duplicated domains in JspFL spanning from Asn23 to Gly163 (N-CRD) and from Asn171 to Gly306 (C-CRD) connected by a nine-residue linker (Tyr162-Glu170).

The deduced amino acid sequence of the sea perch F-lectin was similar to Striped sea bass (83% similarity, E = 5e−132), White bass (84% similarity, E = 5e−132), Killifish (71% similarity, E = 7e−69). Multiple sequence alignments show the predicted sea perch signal peptide cleavage positions, and the two F-type domains are in conserved positions.

Tissue distribution of the JspFL transcripts

Real-time quantitative PCR was employed to quantify the JspFL expression in the tissues of heart, gill, head-kidney, spleen and liver. The amplification specificity for JspFL and β-actin was determined by analyzing the dissociation curves. Only one peak presented in the dissociation curves for both the JspFL and β-actin gene (data not shown), indicating that the amplifications were specific.

JspFL mRNA was found to be constitutively expressed in all the examined tissues with significant variation of expression level. There was a high-level expression of JspFL in head-kidney, while a low-level expression in spleen, gill and heart. The highest level of JspFL expression was detected in head-kidney and the lowest in liver (Fig. 1).
https://static-content.springer.com/image/art%3A10.1007%2Fs11033-010-0490-7/MediaObjects/11033_2010_490_Fig1_HTML.gif
Fig. 1

The expression level of JspFL transcript in different tissues was measured by qRT-PCR. Vertical bars represented the mean ± S.E. (N = 3). HK head-kidney

Quantification of JspFL mRNA expression after LPS stimulation

The temporal expression of the JspFL transcript in spleen of fish after LPS stimulation was shown in Fig. 2. During the first 2 h after LPS stimulation, the JspFL mRNA remained at a low level. At 2 h after stimulation, the expression of the JspFL was up-regulated and there was a significant increase in the relative abundance of JspFL mRNA. At 4 and 6 h post-LPS stimulation, the JspFL gene expression level was 3.7 and 3.5-fold higher than that observed in the control group, respectively. As time progressed, the expression of JspFL mRNA decreased and almost recovered to the original level after 10 h post-stimulation. The expression of JspFL in control and blank groups did not significantly change at all time point. An unpaired, two-tailed t-test with blank and challenged groups showed statistically significant difference in JspFL gene expression at 6 h (P < 0.05) post-stimulation. However, no significant difference was observed in other time point in challenge group (Fig. 2).
https://static-content.springer.com/image/art%3A10.1007%2Fs11033-010-0490-7/MediaObjects/11033_2010_490_Fig2_HTML.gif
Fig. 2

Temporal expression of the JspFL transcript in spleen after LPS challenge was measured by qRT-PCR. The mRNA expression of JspFL and β-actin was measured at 0, 2, 4, 6, 8, 10, 16, and 24 h post-injection and blank groups. Vertical bars represented the mean ± S.E. (N = 3). Significant differences across control were indicated with an asterisk at P < 0.05, and with two asterisks at P < 0.01

Discussion

A sugar-binding protein (lectin) and free or cell surface bound sugars constitute an evolutionary-conserved recognition system involved in immunity. Lectins show advantages in the rapidity of their response and are involved in innate defence during disease much earlier than antibodies [24] as well as in complement activation [25]. In fish aquaculture, where stressful conditions facilitate the appearance and diffusion of disease [26], it is crucial for naturally occurring molecules and innate defence mechanisms respond promptly before a specific immunity arises.

In the present study a Japanese sea perch F-type lectin gene was cloned from the spleen stimulated with LPS using the technique of homology. This cDNA contained an open reading frame (ORF) of 930 nucleotides that translated into a predicted 310 amino acid protein. In the protein sequence there is a 18 residues’s signal peptide, and mature peptide 292 residues. This feature of the sequence is similarity with the F-type lectin of the striped sea bass and white bass [22, 23]. It was shown to have the highest homology (similarity 84%, E = 5e−132) with white bass among known protein sequences by BLAST analysis. It has two signature motif of FTP in the protein sequence. So the cloned sequence should be the member of the F-lectin family. The deduced amino acid sequence of the cloned gene protein shows higher similarity when compared with striped sea bass and white bass F-lectin gene, and the signature motif lies in the conserved domains.

The complete JspFL deduced amino acids sequence revealed that this lectin, as same as the M. saxatilis and D. labrax F-lectins, possesses two tandemly arrayed CRDs connected by a nine amino acid peptide linker. Odom and Vasta [27] isolated from serum and liver of the M. saxatilis two fucose-binding lectins of 30 and 32 kDa, each carrying two tandem CRDs that exhibit the F-type carbohydrate-recognition motif and the typical F-type structural fold established for the A. anguilla F-type lectin [12]. There are relevant biochemical and structural similarities between JspFL and the two binary tandem CRD F-type lectins isolated from striped bass [23].

From the sequence of the deduced amino acids, JspFL exhibits differences with the L-Fuc-binding/disulfide motif (C1XHX24RXDC2C2X2(R/K) C3X16 C3X22C1) described in AAA. The N-CRD exhibits a sequence motif (C1XHX24RGDC2 C2XERXX16XX22C1) most similar to AAA, except that it is missing the disulfide between the two β-sheets that form the lectin. In contrast, the C-CRD (C1XHX24RDXXXERC3X16C3X22C1) conserves this structurally relevant disulfide but is missing the contiguous disulfide observed to interact with L-Fuc in AAA [10]. Despite these differences, the basic residues that form hydrogen bonds to L-Fuc are conserved in both domains, suggesting they bind L-Fuc. It is unknown what tertiary structure JspFL adopts, but because the N- and C-terminals exit together in AAA, it is likely that the tandem domains orient opposite to each other.

Soluble lectin types have been recorded in many marine and freshwater fish tissues [2830] such as blood, mucus, serum, and eggs. FBL mRNA could be detected in various tissues of unchallenged sea perch using qRT-PCR, indicating that FBL expression occurs in many sea perch tissues. However, there is some degree of tissue specific expression for this gene because the JspFL transcript in the liver of the unchallenged fish is very weak. FBL transcript expressions in the tissues were a little different in different fish. In striped sea bass [23], its expression is not restricted to the liver, as other organs and tissues also express the F-type lectin gene, such as gill, heart, and brain, which suggests these genes have diverged in their controls for spatial expression. Similarly, several isoforms of the Japanese eel lectin are also expressed in gill [9]. In the adult X. tropicalis the gene is expressed in the liver, lungs, and body fat. But in the D. labrax, the highest transcript levels in liver, followed in decreasing order by intestine, head kidney, spleen, ovary, and transcripts absent in gill and heart [31]. So the F-type lectin gene expression is constitutive, also have some difference in fish tissues.

LPS acts as a powerful stimulator of innate immunity in diverse eukaryotic species [3133]. LPS is known to stimulate monocytes, macrophages, and neutrophils through the activation of transcription factors resulting in increased proinflammatory responses, associated with release of cytokines and other soluble mediators [34, 35]. In mammalian, it has been shown to increase lectin expression in response to LPS. Lectins play important roles in the immune response of invertebrates and vertebrates either by recognizing exposed glycans of potential pathogens or by their immunoregulatory roles through the binding to carbohydrates on the surfaces of immunocompetent cells [31, 3640].

In the present study, after LPS treatment, the expression level of JspFL was not changed significantly during the first 2 h after LPS stimulation, and then up-regulated and increased significantly at 2 h after LPS stimulation. The expression level of JspFL at 4 h post-LPS stimulation was the highest, and from the 6 h post-LPS stimulation the expression level became to decrease. The result indicted that JspFL was a constitutive and inducible acute-phase protein and could play a critical role in the immune response to the infection of bacterial. More characterisation of the biological effects of F-lectin in sea perch awaits production of the recombinant molecule.

Acknowledgments

This work was supported by a grant from the GuangDong Province of China (2005B20301023).

Copyright information

© Springer Science+Business Media B.V. 2010