Molecular Biology Reports

, Volume 37, Issue 2, pp 745–753

Screening of genes induced by salt stress from Alfalfa

Authors

  • Houcong Jin
    • Institute of Animal SciencesChinese Academy of Agricultural Sciences
    • College of AgronomyInner Mongolia Agricultural University
  • Yan Sun
    • College of Animal Science and TechnologyChina Agriculture University
    • Institute of Animal SciencesChinese Academy of Agricultural Sciences
  • Yuehui Chao
    • Institute of Animal SciencesChinese Academy of Agricultural Sciences
  • Junmei Kang
    • Institute of Animal SciencesChinese Academy of Agricultural Sciences
  • Hong Jin
    • College of AgronomyInner Mongolia Agricultural University
  • Yan Li
    • Institute of Animal SciencesChinese Academy of Agricultural Sciences
  • Gruber Margaret
    • Saskatoon Research CentreAgriculture and Agri-Food
Article

DOI: 10.1007/s11033-009-9590-7

Cite this article as:
Jin, H., Sun, Y., Yang, Q. et al. Mol Biol Rep (2010) 37: 745. doi:10.1007/s11033-009-9590-7

Abstract

An alfalfa cDNA library induced by salt stress was constructed by suppression subtraction hybridization (SSH) technology. Total RNA from 10-day-old seedlings was used as a “driver,” and total RNA from seedlings induced by salt was used as a “tester”. One hundred and nineteen clones identified as positive clones by reverse Northern dot-blotting resulted in 82 uni-ESTs comprised of 16 contigs and 66 singletons. Blast analysis of deduced protein sequences revealed that 51 ESTs had identity similar to proteins with known function, while 24 could not be annotated at all. Most of the annotated sequences were homologous to genes involved in abiotic or biotic stress in plants. Among these proteins, beta-amylase, fructose-1,6-bisphosphate, aldolase, and sucrose synthase are related to osmolyte synthesis; a CCCH-type zinc finger protein, DNA binding protein, His–Asp phosphotransfer protein, and the RelA/SpoT protein partake in transcription regulation and signal transduction; and ribulose-l,5-bisphosphate carboxylase/oxygenase, chlorophyll a/b binding proteins, and an early light-inducible proteins are related to photosynthesis. In addition, several ESTs, similar to genes from other plant species, closely involved in salt stress were isolated from alfalfa, such as an aquaporin protein, a late embryogenesis-abundant protein, and glutathione peroxidase.

Keywords

Suppression subtractive hybridization (SSH)Alfalfa (Medicago sativa L.)SMART technologyReverse Northern dot-blottingSalt stressReal-time PCR

Introduction

In the process of growth, plants are subjected to all kinds of biotic and abiotic stress. To cope with these stresses, plants have developed arrays of physiological and biochemical strategies to adapt to the adverse conditions [1]. Soil salinity is one of the most significant abiotic stresses for crop plants. Salt tolerance is a complex trait involving responses to cellular osmotic and ionic stresses and their consequent secondary stresses (e.g., oxidative stress) and whole plant coordination. The complexity and polygenic nature of salt stress tolerance are important factors contributing to the difficulties associated with breeding salt-tolerant crop varieties. Understanding how plants respond to salt stress can play an important role in stabilizing crop performance under saline condition.

Under salinity stress, a large number of proteins concerned with compartmentalization, regulation of gene expression and detoxification can be induced in plants [2]. Sodium compartmentalization in vacuoles is one of the most important strategies that plant cells use to resist salt stress [3]. Abundant researches had proven that accumulation of Na+/H+ antiporter in vacuolar membrane could dramatically improve plant salt tolerance [4]. At present, many stress-induced genes related to transcription factors, osmolyte synthesis and detoxification have been isolated and identified. Among transcription factors, members of the AP2/EREBP, bZIP, zinc finger, and MYB families have been well characterized for their regulatory roles in plant stress or defense responses, salt stress [57]. Many efforts had been reported to improve salt stress resistance of plants by over-expressing stress-responsive transcription factor genes, such as DREB/CBF [8], CARAV1 [9], OPBP1 [10] and ThZF1 [11]. Salt stress also induces biosynthesis genes encoding osmo-protectants which function in maintaining homeostasis and directly improve plant salt tolerance, such as polyols, sugars, amino acids (praline) and betaines, [12, 13]. In addition, many genes induced by salt stress can inhibit or repair damage [14]. Detoxification enzymes include superoxide dismutase (SOD), catalase (CAT) and glutathione reductase (GR), which can remove the reactive oxygen species (ROS) hydrogen peroxide, superoxide anion, and hydroxyl radical. [15].

Suppression subtractive hybridization (SSH) is a gene identification method which has gained favour in recent years for eukaryotic applications. This method can develop libraries that include both and abundant genes, potentially yielding a more diverse gene pool than other techniques that isolate response-specific genes. SSH technology has been used to develop cDNA libraries and to characterize genes of widely diverse plant species in response to salt stress, including early responses from Salicornia bigelovii Torr. [16] and responses by Medicago truncatula roots during salt stress and recovery of root growth [17]. A salinity-induced gene encoding the DEAD-box helicase from the halophyte Apocynum venetum has been isolated and characterized by SSH technology [18].

Alfalfa (Medicago sativa) is an important leguminous forage crop worldwide. Salinity problems in agriculture represents a major constraint in the productivity of crops and forage pastures [3]. Alfalfa plants are able to fix nitrogen in symbiotic association with rhizobia and, like many crops, are sensitive to high salt conditions. Salt stress imposed by 50–200 mM NaCl significantly limits productivity of alfalfa [19]. Recently, many genes induced by salt stress were cloned and characterized from alfalfa and several genes were over-expressed in alfalfa to enhance salt tolerance [20]. But most of them focused on one gene. Our current work is focused on construction of a cDNA library by SSH to acquire gene expression profiles of alfalfa influenced by salt stress. SSH was proven to be an efficient technology at identifying differentially-expressed, low abundance genes and has a low proportion of false positives clones [21].

Materials and methods

Plant materials and treatments

Seeds of a salt-tolerant alfalfa cultivar M. sativa L. cv. “Zhongmu NO. 1”, bred by Qingchuan Yang at the Chinese Academy of Agricultural Sciences in 1997, were sown in a plate filled with silicon dioxide sand and were irrigated with deionized water daily. After 10 days, the seedlings were treated with 200 mmol l−1 NaCl for 0, 10 or 30 min or 1, 3, 6, 12, or 24 h, respectively, and then frozen in liquid nitrogen and conserved at −80°C.

Extraction of total RNA and construction of SSH library

Total RNA from seedlings was extracted using isothiocyanate, and analyzed by agarose gel electrophoresis and UV spectrophotometry. Total RNAs extracted from plants treated with seven salt treatments (from 10 min to 24 h) were mixed together in equal proportions and used as the tester. RNA without treatment was used as control material. A SMART™ PCR cDNA synthesis kit (Clontech, USA) was used in the synthesis of tester and control cDNA according to the manufacturer’s instructions. After reverse transcription, 5′ PCR Primer II A from the kit was used to prime PCR amplification. An aliquote (15 μl) of the PCR reactions was analyzed by agarose gel electrophoresis at 15, 18, 21, and 24 cycles to optimize the number of PCR cycles.

Suppression subtraction hybridization was carried out using the PCR-Selected cDNA Subtraction Kit (Clontech) according to the manufacturer’s instructions. SMART cDNAs synthesized from tester and driver were digested by RsaI. Superfluous denatured control cDNA without adaptor was added into each of two tester cDNA batches that had been ligated either with adaptor 1 or 2R, respectively. For the first subtraction, each of the two cDNA testor batches were denatured at 98°C for 1.5 min and then hybridized at 68°C for 8 h. Subsequently, the two testor batches were combined and freshly denatured control cDNA was added into the mixture for a second overnight hybridization at 68°C. Products of the second hybridization were amplified with two rounds of selective PCR. The resulting PCR products were purified and inserted into pMD18-T vector (Takara, Japan), then transformed into E. coli DH5α. Recombinant white colonies were selected and the length of inserted segments in the library was determined by PCR using nested primers.

Reverse Northern dot-blotting and sequencing of subtracted library

Salt-induced positive clones were screened from the SSH cDNA library using reverse Northern dot-blotting. Secondary PCR products of non-subtracted tester and control products that had ligated with adaptor 1 and 2R were digested by RsaI and then used as templates to develop tester and control probes. A DIG-HIGH Prime DNA Labeling and Detection Starter Kit I (Roche, Germany) was using to label probes which were used for hybridization and detection according to the user manual. PCR products (2 μl) of amplified clones were dotted on nylon membranes and then hybridized sequentially with tester and control probes at 42°C overnight. After hybridization, a nonstringent wash with 2× SSC/0.5% SDS and a stringent wash with 0.5× SSC/0.5% SDS were carried out. DIG antibody conjugated to alkaline phosphatase was used as the detection system. Membranes were scanned and dots on the tester membrane with grey scale two fold more than those on the control membrane were selected as positive clones. Positive clones selected by dot-blotting were sequenced by Autolab Co., Ltd (Beijing, China). EST sequences were analyzed for homology by BLASTx in NCBI (http://www.ncbi.nlm.nih.gov/BLAST) and classified according to the MIPS database (http://mips.gsf.de/proj/funcatDB/search_main_frame.html) and AMIGO (http://amigo.geneontology.org/cgi-bin/amigo/go.cgi).

Real time semi-quantitative PCR to check the result of reverse Northern dot-blotting

Real-time semi-quantitative reverse transcriptase PCR was used to characterize six salt-induced ESTs with unknown or putative functions unknown using primers listed in Table 1. Total salt-induced RNA batches were isolated from 10-day-old alfalfa seedlings induced by 200 mmol/l NaCl for 0, 10 or 30 min or for 1, 3, 6, 12 h or 24 h and reverse transcripted by M-MLV RTase. A SYBR green reporter assay kit (Qiagen) was used for detection in the real-time PCR assay with the Medicago truncatula 18S rRNA as an endogenous control sequence. Amplification conditions were optimized for an ABI PRISM® 7700 instrument, and the subsequent analyses showed a single PCR product during melting curve and electrophoresis analysis. Cycling condition optimization was followed by 40 repetitive cycles at 95°C for 15 s and 72°C for 1 min.
Table 1

Sequence of primers for real-time PCR

Number of target EST

Primer name

Sequence (5′–3′)

490

490-1

ATTATCACCAGTCCCAAACCAAA

490-2

TCCACCACCAGTATTAAATGAGG

751

751-1

TGATGAACCGTATAGGCTGACA

751-2

CCTAGATTCTGCAATTCACAAGA

305

305-1

CACCAAAGAAATAGACTCGACCAC

305-2

AGAGGAACGCAAGCAGTAACATC

615

615-1

GGTCCAAGTATGAAACCACTGCTCG

615-2

TGACAAATGGAACTAAAGGAACAGA

119

119-1

TGGTAATGGAATTGGAGGTGGAT

119-2

GAACGGCTGAATGAGGAGAAACA

32

32-1

CAAGTTCGGTGCTGTCTGTCGTT

32-2

ACGCAGATAGCCCATTTCCAAGA

Results

Optimization of cDNA amplification cycles

The PCR products of SMART cDNA were mainly distributed between 0.7 and 2.0 kb (Fig. 1). The PCR reached its plateau after 24 cycles for “Driver” cDNA and 21 cycles for “Tester” cDNA; that is, the yield of PCR products stopped increasing. Therefore, the optimal number of cycles was determined to be 23 for “Driver” cDNA and 20 for “Tester” cDNA as outlined in the Super SMARTTM PCR cDNA Synthesis Kit User Manual.
https://static-content.springer.com/image/art%3A10.1007%2Fs11033-009-9590-7/MediaObjects/11033_2009_9590_Fig1_HTML.gif
Fig. 1

Analysis for optimizing PCR parameters. Aliquots (5 μl) of each PCR product were electrophoresed on a 1.0% agarose/EtBr gel in 1× TAE buffer following the indicated number of PCR cycles (15, 18, 21 and 24). The PCR reactions for non-induced ‘driver” reactions and for salt-induced “testor” reactions reached a plateau after 24 and 21 cycles, respectively; that is, the yield of PCR products stopped increasing. After these plateaus were reached, a smear appeared in the high-molecular-weight region of the gel, indicating that the reactions were over-cycled. Lane M: DNA Marker DL2000

Reverse Northern dot-blotting and analysis of sequence

A cDNA library containing 810 clones was constructed by SSH technology. Inserted segments ranged from 250 to 750 bp in PCR amplification tests with nested primers. Reverse Northern dot-blotting of these clones resulted in 119 salt-induced positive clones (Fig. 2). After sequencing and cluster analysis using DNAMAN, 82 unique transcripts (including 16 contigs and 66 singleton sequences) were obtained out of 110 available ESTs. This uni-EST set included 58 with high amino acid sequence homology to proteins with known function or putative function in the NCBI, MIPS, or AMIGO databases. Six additional uni-ESTs had homology to non-annotated genes from other plant species, while 19 had no homologues at all. The 19 uni-ESTs may be either new genes or segments unique to alfalfa and located in 5′ or 3′ non-translated regions.
https://static-content.springer.com/image/art%3A10.1007%2Fs11033-009-9590-7/MediaObjects/11033_2009_9590_Fig2_HTML.gif
Fig. 2

Differential screening of representative positive clones from the SSH subtracted alfalfa library. In total, 810 clones of subtracted cDNA were arrayed on positively charged nylon membranes and hybridized to different probes labeled by DIG. Clones which displayed a stronger signal in panel B than in panel were selected as candidate clones for sequencing and further characterization (e.g, a10, b2, b10, c1 and c3.). a Clones hybridized to control probe. Spots marked with open squares were identified as positive clones. b Clones hybridized to salt-induced tester probe

BLASTx analysis of the 65 uni-ESTs with known or putative function is shown in Table 2. Classification or these proteins indicated 24% of the 82 salt-induced ESTs were related to metabolism Genes. Additionally, a relatively large proportion of genes (9%) were classified into group seven (abiotic stress-related), including stress-resistant osmoprotectant proteins and sequences for the deactivation of ROS (Table 3).
Table 2

BLASTx analysis and categorization of salt-induced alfalfa genes

Accession no. (ESTs)

Clone no.

Closest homologous protein

Accession no. (Closest homologue)

Species (Homologue)

E value

GO No.

Material and energy metabolism

54755887

7

Putative fructose-bisphosphate aldolase

BAE72118.1

Trifolium pratense

4.00E-97

0006098

54755898

297

Ribulose-1,5-bisphosphate carboxylase small subunit

AAC13293.1

Medicago sativa

8.00E-102

0015977

54755901

306

Plastidic aldolase

AF411551_1

Medicago sativa

4.00E-42

0006098

54755915

491

Ribulose-1,5-bisphosphate carboxylase small subunit

AAC13293.1

Medicago sativa

6.00E-95

0015977

54755949

372

Galactinol synthase

AAM97493.1

Medicago sativa

5.00E-23

0016758

54755943

141

Myo-inositol 1-phosphate synthase

CAH68559.2

Phaseolus vulgaris

1.00E-50

0004512

54755952

520

Galactinol synthase

AAM97493.1

Medicago sativa

9.00E-20

0016757

54755919

599

Beta-amylase 7

NP_189034.1

Arabidopsis thaliana

9.00E-45

0016161

54755921

629

Sucrose synthase

ABY82048.1|

Hymenaea courbaril var. stilbocarpa

2.00E-58

0016157

54755929

40

Myo-inositol 1-phosphate synthase

CAQ03497.1

Phaseolus vulgaris

1.00E-11

0004512

54755934

656

Galactinol synthase

AAM97493.1

Medicago sativa

3.00E-98

0016757

54755953

536

D-myo-inositol 3-phosphate synthase

ABM17058.1

Glycine max

2.00E-99

0004512

54755937

508

Myo-inositol-1-phosphate synthases

ABO77439.1

Medicago sativa

3.00E-33

0004512

54755963

683

Sterol desaturase, putative

ABD28318.1

Medicago truncatula

2.00E-36

0009924

54755967

825

Putative alcohol dehydrogenase

AAC23647.1

Arabidopsis thaliana

4.00E-16

0008106

54755912

477

Ribulose-1,5-bisphosphate carboxylase small subunit

AAC13293.1

Medicago sativa

2.00E-14

0015977

54755959

582

Myo-inositol-1-phosphate synthase

ABC55422.1

Glycine max

2.00E-82

0004512

54755924

719

Myo-inositol-1-phosphate synthases

ABO77439.1

Medicago sativa

3.00E-33

0004512

54755962

664

Citrate synthase

AAC16084.2

Arabidopsis thaliana

8.00E-37

0003878

54755928

833

Glyceraldehyde-3-phosphate dehydrogenase

CAA36396.1

Pisum sativum

2.00E-61

0008943

Transcription

54755956

551

DEAD BOX RNA helicase RH15-like protein

CAB96652.1

Arabidopsis thaliana

3.00E-63

0008026

54755936

660

Ankyrin

ABD32722.1

Medicago truncatula

2.00E-29

0003700

54755965

727

Glycine rich protein-like

AAM65462.1

Arabidopsis thaliana

2.00E-19

0005732

54755958

560

Homeobox-leucine zipper protein ATHB-12

AAL24310.1

Arabidopsis thaliana

5.00E-10

0006355

Protein fate

54755920

615

Unknown

   

0004842

54755938

22

Putative FKBP-type peptidyl-prolyl cis-trans isomerase

AAO50622.1

Arabidopsis thaliana

3.00E-15

0003755

Protein with binding function or cofactor requirement

54755889

32

Zinc finger, CCCH-type; Sugar transporter superfamily

ABD28369.2

Medicago truncatula

9.00E-86

0004518

54755922

665

Enzymatic resistance protein

AAZ94162.1

Glycine max

1.00E-23

0004760

54755939

23

Putative DNA binding protein

BAE71189.1

Trifolium pratense

1.00E-33

0003723

54755918

594

Type 1 metallothionein

AF189766.1

Medicago sativa

5.00E-27

0005507

54755945

193

RPT2 (ROOT PHOTOTROPISM 2); protein binding

NP_850147.1

Arabidopsis thaliana

3.00E-21

0005515

Transport

54755913

488

Aquaporin-like transmembrane channel protein

AAB86380.1

Medicago sativa

4.00E-40

0015250

54755942

59

Putative non-specific lipid transfer protein nLTP

NP_181958.1

Arabidopsis thaliana

1.00E-06

0006869

54755961

632

Lipid transfer protein 5 precursor

AAX35809.1

Lens culinaris

6.00E-33

0006869

Cellular communication/signal transduction mechanism

54755941

54

Putative His–Asp phosphotransfer protein

CAH55772.1

Pisum sativum

5.00E-05

0009927

Cell rescue, defense and virulence and interaction with the environment

54755950

406

Indole-3-acetic acid-induced protein ARG2

BAA03307.1

Vigna radiata

4.00E-25

0000302

54755894

140

Aquaporin

AAL32127.1

Medicago truncatula

3.00E-56

0009414

54755895

169

Sucrose synthase

ABP88869.1

Medicago sativa

1.00E-59

0006970

54755897

270

Early light inducible protein

AF383622_1

Medicago sativa

1.00E-31

0009409

54755911

465

Aquaporin 1

AF255795_1

Allium cepa

6.00E-49

0009414

54755907

427

ATHVA22E

NP_568744.1

Arabidopsis thaliana

2.00E-17

0042538

54755927

784

Glutathione peroxidase 1

AAP69867.1

Lotus japonicus

1.00E-32

0004602

Development

54755909

463

Seed maturation protein

AAA91965.1

Glycine max

3.00E-22

0009793

Subcellular localization

 

54755914

490

Unnamed protein product

CAO71220.1

Vitis vinifera

5.00E-21

0031225

54755916

566

Tubulin beta-2/beta-3 chain

BAD93731.1

Arabidopsis thaliana

5.00E-74

0045298

Unclassified

54755892

119

Glycine-rich protein

NP_193893.1

Arabidopsis thaliana

3.00E-09

0008150

54755905

404

Putative chloroplast chlorophyll a/b binding protein

BAF95850.1

Vitis hybrid cultivar

5.00E-10

0016168

54755946

230

WD-40 repeat family protein, putative

ABF96310.1

Oryza sativa

3.00E-33

0008150

54755925

725

Unnamed protein product

CAO44310.1

Vitis vinifera

1.00E-08

0003674

54755931

290

WD-40 repeat family protein

NP_974167.1

Arabidopsis thaliana

8.00E-16

0003674

54755935

659

Raffinose synthase

ABK55684.1

Cucumis sativus

4.00E-37

0010325

54755893

133

Unknown

ABK92698.1

Populus trichocarpa

4.00E-13

0003674

54755930

136

Unnamed protein product

CAO17934.1

Vitis vinifera

2.00E-09

0003674

54755957

555

Putative fatty acid desaturase RDZIP

AAP83875.1

Rosa davurica

2.00E-44

0048529

54755964

723

O-diphenol-O-methyl transferase

CAB65279.1

Medicago sativa

8.00E-38

0008150

54755940

26

Putative 4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein

AAM60860.1

Arabidopsis thaliana

2.00E-68

 

54755926

751

Unnamed protein product

CAO63391.1

Vitis vinifera

2.00E-09

 

54755932

401

Cold acclimation-specific protein

AAA21185.1

Medicago sativa

0.003

 

54755923

707

Little protein 1

AAS55470.1

Oryza sativa

8.00E-19

 

54755902

363

Glutaminase

NP_681388.1

Thermosynechococcus elongatus

1.7

 

54755903

379

Octicosapeptide/Phox/Bem1p

ABD32345.1

Medicago truncatula

1.00E-31

 

54755896

213

Ribulose 1,5-bisphosphate carboxylase small subunit propeptide

AAA33686.2

Pisum sativum

0.19

 

54755891

95

Unknown

ABK28123.1

Arabidopsis thaliana

4.00E-19

 

54755948

265

RelA-SpoT homolog 1

CAJ00006.1

Medicago truncatula

1.00E-36

 
Table 3

Gene categorization by their function

Category

Description

Percent (%)

Frequency

1

Material and energy metabolism

24

20

2

Transcription

4

4

3

Protein fate

2

2

4

Binding protein or cofactor requirement

6

5

5

Transport

3

3

6

Cellular communication/signal transduction mechanism

1

1

7

Cell rescue, defense and virulence and interaction with the environment

8

7

8

Development

1

1

9

Subcellular localization

2

2

10

Unclassified

23

19

11

No homologous protein

21

18

Real-time RT-PCR analysis

Real-time PCR analysis showed that the expression level of six salt-induced ESTs tended to be increased after salt stress, although there were some individual fluctuations. It also confirmed the reverse Northern dot-blot pattern of saline induction. The transcription of four of these sequences (751, 305, 615 and 32) reached their highest level early when plants were induced for 30 min and then declined. Three of these genes (751, 305 and 615) had a 2nd transcript maximum several hours later, suggesting they may encode proteins that act in signal transduction or in the control of transcription of other genes. The expression of gene 32 could be detected at different times induced by salt, and at 30 min after treatment, the expression reached maximum. This expression pattern implies that the gene might play a role in the response of plants to salt stress. Gene 119, which reaches maximum at 6 h after the initiation of the salt stress, is a homologue of an Arabidopsis glycine-rich gene and might encode a protein that terminates signal transduction after salt stress.

Discussion

In this study, we succeeded in constructing a SSH cDNA library using RNA from seedlings treated for seven different time periods with a high salt stress (200 mM). Most sequences identified from this library encoded genes with homology to genes from other species that were related to either abiotic or biotic stress or specifically to salt stress. Six ESTs with unknown or poorly defined functions were selected for analysis of salt-induced expression patterns in these seven stress periods using real-time semi-quantitative PCR and confirmed the reverse Northern dot-blot patterns of expression (Fig. 3). Most other studies, in which SSH cDNA libraries were screened for salt-related genes in large-scale efforts, involved one time period only. From these reports, it is clear that some gene induction patterns are rapid and dynamic and may not be detected by salt stress applied for only one time period. For example, the expression of AtSZF1 and AtSZF2 is quickly and transiently induced by NaCl treatment [22]. Hence, our SSH cDNA library was constructed to include genes induced by salt in many different patterns and so that it contained the majority of induced genes, including those induced very early and those induced later on.
https://static-content.springer.com/image/art%3A10.1007%2Fs11033-009-9590-7/MediaObjects/11033_2009_9590_Fig3_HTML.gif
Fig. 3

Real-time PCR analysis of expression patterns of six ESTs substantially induced in the salt-induced library. The six ESTs were designated 490, 751, 305, 615, 119, 32. Ten-day-old alfalfa seedlings were induced by salt for 0, 10 or 30 min or for 1, 3, 6, 12 or 24 h. The relative expression level related to tendency of gene expression. The relative expression was calculated as: \( 2^{{ - \Updelta {\text{Ct}}}} = 2 - [{\text{Ct}},{\text{t}}-{\text{Ct}},{\text{r}}] \) Ct: Cycle threshold; Ct,t: Cycle threshold of target gene; Ct,r: Cycle threshold of 18S rRNA

Numerous genes coding glyco-metabolism and osmolyte biosynthesis-related enzymes were up-regulated and recovered from the alfalfa seedlings after salt stress, including fructose-1,6-bisphosphate (FBP) aldolase, sucrose synthase and myo-inositol-1-phosphate synthase. FBP aldolase is a marker enzyme for the glycolytic pathway and is increased in salt-treated rice leaf. It catalyzes the reversible condensation reaction of FBP to dihydroxyacetone phosphate and glyceraldehyde-3-phosphate [23]. Dihydroxyacetone phosphate is a precursor of glycerol synthesis under salt stress, and glycerol acts as an osmo-regulator to prevent damaged from increasing salinity [24]. The expression of sucrose synthase was strongly up-regulated in Arabidopsis and Lycium barbarum L. under salinity stress [25, 26]. Myo-inositol-1-phosphate synthase has been identified in the salt stress-induced halophyte smooth cordgrass [27]. MIP has multiple roles in inositol-mediated phosphate storage (as phytate), signal transduction, and other plant pathways. Proteins encoded by these genes participate in glycolysis, glyconeogenensis, Calvin cycle or other pathways. Their direct or indirect products, such as galactinol, raffinose and sucrose, may act as osmo-protectants to maintain osmotic pressure and to protect plant cells from abiotic stress [28].

Several ESTs related to transcription regulation and signal transduction were isolated from the salt-induced alfalfa SSH library, such as a CCCH-type zinc finger DNA-binding protein and homeodomain-leucine zipper (HD-Zip) proteins. The functions of most of these factors is not known clearly. Earlier, we had isolated an EST homologous to homeobox-leucine zipper protein Athb-12. HD-Zip proteins function as a mediator of plant development, coupling the developmental response to an environmental signal [29]. Athb7, and Athb12 genes are induced by abscisic acid (ABA) or water stress [30]. Several other ESTs with homologues in signal transduction pathways also were isolated, including an EST containing a WD repeat. WD-40 repeat proteins are involved in diverse cellular pathways such as signal transduction, pre-mRNA splicing, transcriptional regulation, cytoskeletal assembly, and vesicular traffic [31].

We also identified three proteins involved in photosynthesis, ribulose-l,5-bisphosphate carboxylase/oxygenase (RuBisCo) small subunits, the chloroplast light harvesting AB protein (CAB), and an early light-inducible protein (ELIP). ERuBisCo small subunits were also up-regulated after salt treatment in rice [32]. ELIPs are produced rapidly after transfer of Tamarix plants into high light or when placed under NaHCO3 stress [33]. Accumulation of ELIPs under drought, salinity, high light, ABA, etc. plays a critical role in protection and repair of the photosynthetic apparatus of the resurrection plant [34].

Several ESTs specifically related to salt stress resistance were also recovered from the alfalfa salt-induced SSH library, including glutathione peroxidase, late-embryogenesis-abundant (LEA) proteins, and HVA22. Glutathione peroxidases are a family of isozymes which catalyze the reduction of H2O2 and organic and lipid hydroperoxides by oxidizing reduced glutathione and thus help to protect cells against oxidative damage in view of the fact that many stresses, such as drought, cold, biotic stress and probably salt stress, induce the formation of ROS [35]. LEA proteins may play a protective role in plant cell under various stress conditions and this protective role may be essential for the survival of the plant under extreme stress conditions [36]. Most LEA proteins accumulate in immature seeds, seedlings or vegetative tissues with exogenous ABA, drought, salinity or temperature stress [37]. The putative HVA22 isolated from the library may also be a seed maturation protein. This gene is an ABA- and stress-inducible gene which was first isolated from barley (Hordeum vulgare L.) [38]. AtHVA22 homologues are differentially regulated by ABA, cold, dehydration and salt stresses, and some of these AtHVA22 family members may play a role in stress tolerance [39].

Several ESTs have been reported to be induced by other forms of abiotic stress, not only by salinity [40]. It has been suggested that different environmental stresses may result in similar non-specific responses at the cellular and molecular level, in addition to stress-specific responses. This is due to the fact that multiple stressors trigger similar downstream signal transduction chains. A good example of a non-specific response to multiple stressors is water deficiency, e.g., under drought, salinity and cold (especially frost) conditions.

In sum, most of our salt-inducted SSH alfalfa ESTs have a known or putative function, but some of the ESTs have completely unknown functions or have never been recovered from other plant species. These genes might have functions that play a role in salt resistance or salt sensitivity. Knowledge of their functions would be useful towards understanding the mechanisms that underly responses to saline environments and in developing marker for breeding salt-tolerant populations of alfalfa. Our next step is to clone full-length copies of these unknown genes and to analyze their functions. Already a full-length copy of the gene encoding M. sativa zinc finger protein has been obtained and the sequence submitted to GenBank (Access. No. EU624138). Over-expression and RNAi studies and yeast two-hybrid techniques would be useful tools to help identify functions of these unknown genes.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (30871819).

Copyright information

© Springer Science+Business Media B.V. 2009