Molecular Biology Reports

, Volume 36, Issue 2, pp 381–388

Inhibition on Hepatitis B virus in vitro of recombinant MAP30 from bitter melon

Authors

    • The Laboratory of Toxicology, College of Public HealthZhengzhou University
  • Qiao Zhang
    • The Laboratory of Toxicology, College of Public HealthZhengzhou University
  • Jun Xu
    • School of Life SciencesHenan Agricultural University
  • Sha Zhu
    • Department of Microbiology and Immunology, College of Basic Medical SciencesZhengzhou University
  • Tao Ke
    • School of Life SciencesNanYang Normal University
  • De Fu Gao
    • College of Basic Medical SciencesHenan Institute of Traditional Chinese Medicine
  • Yu Bao Xu
    • The Laboratory of Toxicology, College of Public HealthZhengzhou University
Article

DOI: 10.1007/s11033-007-9191-2

Cite this article as:
Fan, J.M., Zhang, Q., Xu, J. et al. Mol Biol Rep (2009) 36: 381. doi:10.1007/s11033-007-9191-2

Abstract

The gene encoding MAP30 protein was cloned from bitter melon and recombinant MAP30 was expressed and purified. The human hepatoma G2.2.15 cells were exposed to different concentrations of MAP30. MTT assay was used to evaluate the cytotoxicity of the drugs and real-time PCR and Southern hybridization were applied to quantify extracellular HBV DNA and replicative intermediates intracellular and cccDNA in nucleus. HBsAg and HBeAg were assessed by enzyme-linked immunosorbent assay (ELISA). The results showed that exposure of HepG2.2.15 cells to MAP30 resulted in inhibition of HBV DNA replication and HBsAg secretion. After exposed to three different concentrations of MAP30 for 2, 4, 6, and 8 days respectively, the inhibition rates of extracellular HBV DNA, HBsAg, and HBeAg of each concentration decreased significantly (P < 0.05). After 9 days of treatment, the inhibition rates of extracellular HBV DNA of the different concentrations differed greatly (P < 0.001). The MAP30 could inhibit the production of HBV (P < 0.01) dose-dependently. The expression of HBsAg was significantly decreased by MAP30 dose-dependently (P < 0.001) and time-dependently (P < 0.001). Lower dose of MAP30 (8.0 μg/ml) could inhibit the expression of HBsAg and HBeAg.

Keywords

Bitter melonHBV DNAHepG2.2.15 cellsMAP30MTTReplicative intermediates

Introduction

Hepatitis B virus (HBV) infection remains a major public health problem worldwide [14] and causes transient and chronic infection of Liver [5, 6]. At present, about 3.5 hundred million people are infected with HBV, and about 1 million people die of Hepatitis B virus (HBV) infection or related diseases each year, ranking 9th in disease deaths [7, 8]. There are no effective therapies for HBV infection. The available treatments are of limited efficacy, such as interferon-α (INF-α) [9, 10], nucleoside analog [1113], and gene therapy strategy [14]. However, the rapid development of drug resistance remains a growing concern and alternative approaches to inhibit HBV replication are urged.

MAP30 is a plant protein obtained from Momordica charantia (bitter melon), whose extracts have been used as therapeutic agents for centuries. Recent interest in MAP30 has been stimulated by reports [15, 16] of potent anti-tumor activity against human cancer cell lines and inhibition of HIV-1 infection in lymphocytes and monocytes, and viral replication, MAP30 toxicity is specific to tumor-transformed or viral-infected cells. It shows no adverse effects on normal cells, making it a candidate for clinical applications. RIP RNG (RNA N-glycosidase) activity is distinct from anti-HIV/tumor activity [17, 18], while MAP30 and related RIPs inhibit HIV-1 in both T cells and macro-phages at concentrations that show little effect on ribosome function [19]. These observations suggest that mechanisms, unrelated to ribosome inactivation, may contribute to RIP anti-HIV/tumor activities [20].

The ability of MAP30 to interrupt essential topological interconversions of viral DNA and ribosomal function of rRNA in viral-infected cells may provide novel mechanisms for its antiviral actions. Recently, through the Anti-Cancer Drug Screening Program of the National Cancer Institute [21], we found that MAP30 also has potent anti-tumor activity against certain human tumor cell lines. Recently there has been intense community interest in the use of bitter melon, the source of MAP30, as an alternative therapy for HIV-l infection. In addition to MAP30, extracts of bitter melon contain many other components which are not well characterized and which may contain undefined biological activities. Cloning of MAP30 is important because it not only enables the large scale production of MAP30, but also provides a useful system for genetic manipulation in the rational development of this therapeutic agent. For these reasons, we have cloned and expressed the MAP30. In this study, the anti-HBV activity of MAP30 was investigated in HepG2.2.15 cells and the antiviral potential of MAP30 on the kinetics of HBV genome replication was evaluated. Our results showed that sequential treatment with MAP30 leads to effective suppression of HBV gene expression and genome replication.

Materials and methods

Materials

All reagents and culture media were purchased from the Sigma Chemical (USA) unless noted otherwise. Ni-NTA-agrose was purchased from Amersham Pharmacia Biotech. The pET-28a expression system in Escherichia coli BL21 (DE3) was obtained from Novagen Company (USA). Protein molecular mass markers, IPTG and G418, imidazole and MTT were all from Sino-American Biotech.

Cloning and expression of MAP30

Specific primers were designed according to MAP30 sequence reported by Lee-Huang (accession number S79450). The forward primer is 5′GCCTCGAGTCAATTCACAACAGATTCCCC3′. The reverse primer is 5′GCGAATTCATGGATGTTAACTTCGATTTGTC3′. The cDNA fragment encoding the MAP30 was amplified by RT-PCR with specific primers and template of bitter melon total RNA. The amplified fragment was cloned into pGEMT-Easy vector and confirmed correct by sequencing. The cloned gene was subcloned into the EcoRI and Xhol I site of pET-28a (Novagen) and expressed in E. coli BL21 (DE3). After induction with IPTG at a final concentration of 1 mM and growing for 5 h at 28°C with continuous shaking, cells were collected by centrifugation, resuspended in binding buffer (50 mM phosphate sodium, 300 mM sodium chloride) and sonicated. Affinity purification of 6-His recombinant MAP30 from the soluble fraction was carried out with Ni-NTA His•Bind® Resin (Novagen) according to the manufacturer’s instruction. The soluble supernatant was transferred to the column. It was washed with three column volumes of wash buffer (300 mM NaCl, 20 mM sodium phosphate, pH 8.0). The desired protein was eluted with elution buffer which contains 150 mM imidazole. The purified protein was applied to antiviral activity assays. Among the experiments involved in using recombinant MAP30, all the controls are using the solutions which are prepared using Ni-NTA affinity method from the cell lysate of E. coli strain BL21 (DE3)/pET28a.

Cell and cell culture

HepG2 cells were obtained from ATCC. HepG2.2.15 cell line derived from HepG2 cells transfected with a plasmid contain 1.3 length genome of HBV (genotype A, subtype adw2) can stably secrete HBsAg and HBeAg antigens, nucleocapsids and virions. They were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco BRL, Grand Island, NY, USA) plus 10% fetal bovine serum (Hyclone, Logan, UT, USA), 380 μg/ml G418 (Sigma, St. Louis, MO, USA) and were grown in humidified incubators at 37°C under 5% CO2. The media were freshed once every 2 days and the cells were passaged every 6 days. When the cells grew to 85% confluence, they were digested and used for the in vitro and in vivo studies. HepG2.2.15 cells in culture medium at 2 × 105 cell/ml was treated at 37°C for 24 h without (positive control) or with various concentrations of serial 2-fold dilutions of MAP30.

Fluorescence microscopy

Fluorescence microscopy HepG2.2.15 cells were seeded in sterile culture dishes on coverslips at a density of 2 × 105/ml and cultured in DMEM medium at 37 in a humidified atmosphere of 5% CO2. Cells were grown to 80–90% confluence and synchronized by incubation in 0.5% DMEM for 56 h. The experiments were divided into test and control groups. Cells in the test group were incubated in 10% DMEM medium containing 80 μg/ml MAP30 for 24 or 48 h. Cells in the control group were incubated in 10% DMEM alone for 24 h. The coverslips were washed with PBS (containing Ca2+, Mg2+) for 3–5 min, then a 1,000:1 mixture of methanol: DAPI was added and placed at four for 15–30 min, and then washed thrice with PBS for 3–5 min to reduce the background signal. Finally, the cells fixed on the coverslips were analyzed, and photographed under fluorescence microscope (BH-2, Olympus, Japan).

Evaluation of drug cytotoxicity to liver cells with MTT assay

Survival rates of cells were detected by MTT method. MTT (methyl thiazolyl tetrazolium) assay was used to evaluate the cytotoxicity of the MAP30 to liver cells. The stock solution of MTT, 3-(4,5-dimethylthiozol-2-yl)-3,5-dipheryl tetrazolium bromide was prepared in sterilized phosphate-buffered saline at 5 mg/ml. HepG2.2.15 cells suspension were prepared to 2 × 105/ml when grow well and 100 μl cell suspension was added into each of the 96-well plastic plate respectively and cultivated. After incubation at 37°C for 24 h, the medium was removed and replaced with fresh medium containing different concentrations of MAP30 every 3 days. The control wells contained an equivalent amount of solvent. After 6 day incubation, the supernatant was removed and 50 μl of MTT was added to the 2.2.15 cell medium, and then cultured for 4 h, DMSO was added till it was dissolved completely, then absorbance (A) of the lysate was read at 490 and 630 nm using an ELISA microtiter plate reader. The value of absorbance at 490 and 630 nm was named A490 and A630. The inhibition rate of liver cells (%) = [1 − averge value of the study holes (A490 − A630)]/average value of the control holes (A490 − A630) × 100%. CC50 represented the concentration of the MAP30 when the inhibition percentage was 50% on proliferating cells. Lower concentrations below CC50 were selected in the following antiviral experiments.

Inhibitory of MAP30 on the expression of HBsAg and HBeAg in vitro were assessed by ELISA

HBsAg and HBeAg levels in the culture medium were determined according to the protocols by ELISA kits (Hua mei Biological Technical Co. Ltd.). The samples were diluted to appropriate concentration when mensurated. The detailed procedure followed the operating instructions. Inhibition rate (%) = [P/N value of negative control hole − P/N value of the study hole)/[P/N value of the negative control holes − 2.1) × 100%.

Real-time quantitative PCR for HBV DNA

DNA was eluted into 100 μl nuclease-free water and 5 μl added to a 25 μl PCR reaction mixture. The reaction was carried out using a commercial SYBRGreen reaction mix (Qiagen, Hilden, Germany). The kit contains HotStarTaq polymerase which is included to avoid false positives in the quantitative PCR. The primer sequences were 5′-GTG TCT GCG GCG TTT TAT CA (sense) and 5′-GAC AAA CGG GCA ACA TAC CTT (antisense) designed to amplify a 98 base pair product from positions 379 to 476 of the HBV genome [22]. The DNA was extracted using an adaptation of the salt-extraction method. To extract the DNA of the intracellular replicative intermediates, the cells treated with different drugs for 6 days were washed two times with cooled PBS, then lyzed in 500 μl lysis buffer (0.5% NP-40, 20 mM Tris, PH 7.5, 150 mM NaCl, and 1 mg/ml bovine serum albumin) for 30 min on ice. Then, the lysate was centrifuged at 2,000 rpm for 5 min, the supernatant were transferred into another tube for DNA extraction, then collected the virons from the cell lyste and the cell culture medium with adding equal volume of 20%PEG-8000 and centrifuged at 12,800 rpm for 20 min after placed at 4°C for 2 h, discarded the supernatant. The pellet was homogenized in 400 μl of sterile salt homogenizing buffer (0.4 M NaCl 10 mM Tris–HCl pH 8.0 and 2 mM EDTA pH 8.0), using a homogenizer, for 10–15 s. Then 40 μl of 20% SDS (2% final concentration) and 8 μl of 20 mg/ml proteinase K (400 mg/ml final concentration) were added and mixed well. The samples were incubated at 55–65°C for at least 1 h or overnight, after which 300 μl of 6 M NaCl (NaCl saturated H2O) was added to each sample. Samples were vortexed for 30 s at maximum speed, and tubes spun down for 30 min at 12,000 rpm. The supernatant was transferred to fresh tubes. An equal volume of isopropanol was added to each sample, mixed well, and samples were incubated at −20°C for 1 h. Samples were then centrifuged for 20 min, 4°C, at 12,000 rpm. The pellet was washed with 70% ethanol, dried and finally resuspended in 30–50 μl sterile ddH2O. Thermal cycling was performed in an ABi 5700 sequence detection system (PE Applied Biosystems, Warrington, UK). Reaction conditions were: 95°C for 15 min followed by 40 cycles of 94°C for 15 s, 55°C for 30 s and 72°C for 30 s. Each test run included positive and negative controls. The performance of the assay was evaluated by comparison with a commercial assay (HBV Monitor, Roche Molecular Systems, Inc., Branchburg, NJ 08876 USA) performed according to the manufacturer’s instructions.

Analysis of HBV DNA

HBV DNA isolated from HepG2.2.15 cells, either untreated or treated with or without antiviral drugs, was analyzed by Southern blotting for replicative intermediates according to standard protocols. Total and cccDNA forms of HBV DNA were isolated essentially as described elsewhere. For total DNA isolation, cells were washed twice with cold PBS and lyzed in 1 ml of cold lysis buffer (50 mmol/l Tris–HCl, pH 8.0, 10 mmol/l EDTA, 150 mmol/l NaCl, 10 g/l SDS) on ice for 10 min. The lysate was collected in an eppendorf tube, and 100 μl of proteinase K (10 g/l) was added, mixed well and incubated at 37°C for 4 h. Following phenol-chloroform-isoamyl alcohol extraction, the DNA was precipitated with chilled ethanol in the presence of sodium acetate (pH 5.2) and yeast tRNA. The DNA pellet was washed with 700 ml/l ethanol, air-dried, dissolved in 30 μl of TE (pH 8.0) and stored at 4°C for further use. For isolation of cccDNA, the cells were washed and lyzed as above. The lysate was collected in an eppendorf tube and 250 μl of 2.5 mol/l KCl was added and mixed properly. Following incubation on ice for 30 min, the mixture was centrifuged at 13,000 r/min for 30 min in a microfuge. The supernatant containing viral cccDNA was separated and subjected to phenol-chloroform-isoamyl alcohol extraction and ethanol precipitation, as above. The cccDNA pellet was dried, dissolved in 30 μl of TE and stored at 4°C for further use. Samples were loaded onto 1.3% agarose gels and DNA was blotted onto positively charged nylon membranes (Amersham Biosciences). An HBV full length (3.2 kb) linear DNA was radiolabeled with 32P dCTP, using a nick-translation kit according to manufacturer’s instructions used as a probe. The signals on Southern blots were scanned, and the bands were quantitated by densitometry using the Kodak 1D image analysis software (Kodak Digital Science, Wauwatosa, WI, USA). The signal intensities were expressed as relative pixel values for each blot.

HBV RNA analysis

Total cellularRNAwas isolated by the guanidine thiocyanate method by using standard protocols, and 20 μg of RNA was subjected to Northern blot analysis.

Statistical analysis

All statistical analysis was performed using the SPSS package (SPSS for windows release 13.0. Inc, Chicago, IL, USA). The results were expressed as mean ± SEM for three independent experiments. Tukey honestly significantly different test was used to evaluate the difference between the test sample and untreated control. A P value of <0.05 was considered statistically significant. And also one-way ANOVA was used to evaluate the difference between the test samples.

Results

Prokaryotic expression and purification of bitter melon MAP30

Protein expression analysis was performed by SDS-PAGE (Fig. 1) and a band around 30 kDa was observed in the sample collected at 5 h post-induction. The corresponding band was not observed in the sample of E. coli cells before induction. The recombinant RIP was identified expressed in soluble form and present in supernatant. RIP was purified by affinity column from culture supernatant and examined by SDS-PAGE (Fig. 1).
https://static-content.springer.com/image/art%3A10.1007%2Fs11033-007-9191-2/MediaObjects/11033_2007_9191_Fig1_HTML.gif
Fig. 1

SDS-PAGE and western blot of expression and purification of MAP30 in E. coli. Samples were separated on a 12% SDS-PAGE gel and stained with Coomassie Brilliant Blue. M, Molecular mass protein markers; Lanes 1–2, cell lysates respectively from E. coli strain BL21 (DE3)/pET28a and BL21 (DE3)/pET28a-MAP30 without IPTG induction; lane 3, cell lysates from E. coli BL21 (DE3)/pET 28a-MAP30, with 0.5 mM IPTG induction; lane 4, purified MAP30 by immobilized metal affinity chromatography from E. coli cell; lane 5, Western blotting of MAP30 with an anti-MAP30 monoclonal antibody

Morphological changes

Under fluorescence microscope, untreated HepG2.2.15 cells displayed extended, flat cell bodies with uniform chromatin in the nuclei (Fig. 2a). The HepG2.2.15 cells, treated with 80 μg/ml MAP30 for 24 h, showed there was no significant morphological changes between of treated 2.2.15 cells and those of untreated cells (Fig. 2b).
https://static-content.springer.com/image/art%3A10.1007%2Fs11033-007-9191-2/MediaObjects/11033_2007_9191_Fig2_HTML.gif
Fig. 2

Cell morphology in the presence of (a) and in the absence of (b) the protein using HepG2.2.15 cells and Effect of MAP30 on cell growth curve (c)

Cellular toxicity of MAP30

Cell growth was observed and cell toxicity effect MAP30 to HepG2.2.15 cells was detected by MTT assay. Then the absorbance (A490 nm − A630 nm) was measured. The A value of 2.2.15 cells treated with 0, 10, 20, 40, 80 μg/ml MAP30 was 1.598 ± 0.011, 1.578 ± 0.080, 1.557 ± 0.010, 1.535 ± 0.014, 1.542 ± 0.014 respectively. There were no significant differences between A value of 2.2.15 cells and those of controls (P > 0.05). MAP30 did not show evident toxicity to 2.2.15 cells at low concentration even at a concentration of 80 μg/ml, the results showed that MAP30 has lower toxicity, but at high concentrations it had cytotoxicity, with 50% inhibitory concentration (CC50) of 175 μg/ml (Table 1).
Table 1

Effect-concentration relationship of inhibition of cell growth by MAP30

Concentration (μg/ml)

n

A value (x ± s)

Inhibition rate (%)

0

3

1.598 ± 0.011

0

140

3

1.192 ± 0.036

25.41

180

3

0.724 ± 0.004

54.69

220

3

0.324 ± 0.006

79.72

260

3

0.225 ± 0.004

85.95

300

3

0.164 ± 0.005

89.86

The effect on the expression of viral antigen

After treatment with MAP30, both antigen of HBV could be inhibited simultaneity, dose-dependently and powerfully (P < 0.01; Fig. 3). After 6-days treatment, the HBsAg of HBV was inhibited almost entirely after 6 day treatment, the inhibition rate was 91.3% when the concentration of MAP30 was 60 μg/ml. Amount these concentrations, 60 μg/ml of MAP30 was most effective after 6 days of treatment.
https://static-content.springer.com/image/art%3A10.1007%2Fs11033-007-9191-2/MediaObjects/11033_2007_9191_Fig3_HTML.gif
Fig. 3

Analysis of HBV antigens secreted by HepG2.2.15 cells after six treatment with MAP30. Conditioned medium was collected from each culture at 2, 4, 6 days and analyzed for HBsAg or HBeAg content by ELISA

The effect of MAP30 treatment on HBV DNA content of media from HepG2.2.15 cells

The results of real-time PCR revealed that the MAP30 could inhibit the production of HBV DNA. At 60 μg/ml concentration of MAP30, about 95% HBV DNA was inhibited effective. The copies number of HBV decreased to 105 copies/ml. Treatment with these concentrations of MAP30, the amount of HBV DNA significantly decreased, which is below 105 copies/ml. As the figure shows, the DNA of intracellular replicative intermediates decreased along with the increasing of concentration of MAP30, which was similar to what was observed for extracellular HBV DNA. Levels of replicative intermediates were also progressively downregulated by increasing the length of treatment (Fig. 4). Maximal levels of inhibition were observed after 6 days of MAP30 treatment; at this time, almost 70% of replicative intermediates of HBV were inhibited. But the inhibition effect was not as strong as that of extracellular HBV DNA (Fig. 4).
https://static-content.springer.com/image/art%3A10.1007%2Fs11033-007-9191-2/MediaObjects/11033_2007_9191_Fig4_HTML.gif
Fig. 4

Real-time PCR analysis of effect of MAP30 treatment on extracellular HBV DNA. Levels of replicative intermediates for 6 days

Effect of MAP30 on HBV DNA expression and replication

To better determine the stability of cccDNA, we took MAP30 to block core DNA synthesis and measured its rate of decay. The data of Southern blot showed that a dramatic inhibitory effect on replicative intermediates was observed (Fig. 5). Amplification of cccDNA is a hallmark of the hepadnavirus replication cycle and occurs rapidly after the formation of rcDNA. The levels of cccDNA slowly increased for 2 days before they began to decline in treated cells. The cccDNA levels of MAP30 treated cells declined and cleared faster than untreated cells (Fig. 5). A sudden appearance of high levels of cccDNA forms on the sixth day. The decrease in rcDNA levels was biphasic and characterized by an initial rapid decline, reaching 80% of the pretreatment level after 2 days and then declining more slowly during the next 6 days. The stability of pgRNA was only slightly decreased when cells were treated with MAP30. Almost no inhibition was observed when MAP30 was added following the initiation of RNA synthesis.
https://static-content.springer.com/image/art%3A10.1007%2Fs11033-007-9191-2/MediaObjects/11033_2007_9191_Fig5_HTML.gif
Fig. 5

Twenty micrograms of total cellular RNA was used for Northern blot analysis for viral pgRNA and viral HBV RNA and the cellular gene for GAPDH as a control for loading differences (a) Representative Southern blot (b) and quantitative (densitometry) analysis (c) of effect of MAP30 treatment on HBV DNA replication in transduced HepG2.2.15 cells. Lane M: Molecular markers; lanes 1–2 as blank control (HepG2 cells); lanes 3–6 as untreated HepG2.2.2.15 cells at 2, 4, 6, 8 days; lanes 7–10 as MAP30 treated HepG2.2.2.15 cells at 2, 4, 6, 8 days. Synthesis of viral replicative intermediates: relaxed coil (RC), covalently closed circular (CCC), and single stranded (SS) DNA forms in treated and untreated cells

Discussion

HBV infection is an important health problem worldwide, and the investigation about HBV therapy is a long-standing focus. The development of genetic engineering facilitates the role of gene therapy in anti-HBV therapy [23, 24]. Now, drugs that have very good anti-HBV effects are to be used in clinical treatment; therefore, it is necessary to look for the new valid medicines and treatment methods. One rational approach to the development of drugs for the treatment of HBV infection in patients is to identify those compounds that specifically inhibit HBV DNA replication [25, 26].

The effect of MAP30 on HBV proliferation in vitro was investigated and successfully showed its inhibitory effect on the production of HBsAg and HBeAg assessed by ELISA. Real-time PCR revealed that it also suppresses HBV DNA levels, whereas the inhibitory effect was not observed for cccDNA.

The results clearly demonstrated that MAP30 could inhibit the production of HBV. On the level of expression of antigen, MAP30 showed strong inhibitory effects on of HBsAg. Our finding suggest that host immune tolerance induced by HBeAg during HBV infection might be overcome by MAP30 and thus this compound as a therapeutic could be explored. The real-time PCR data indicated that MAP30 can decrease the HBV replicative intermediates (P < 0.05). However, compare to HBV DNA in the medium, the inhibitory effects were weaker. These results show that there is no correlation between the inhibition of HBeAg and HBsAg levels and the inhibition of HBV DNA level.

The analysis of HBV replicative intermediates in transduced HepG2 cells demonstrated a time-dependent, sequential synthesis of different viral DNA replicative intermediate species. A sudden appearance of high levels of cccDNA forms on the sixth day is likely to result from its accumulating pool in the nuclei of HepG2 cells. The higher dose of MAP30 was effective in suppressing viral replication by altering the kinetics of replicative DNA intermediates but the cccDNA pool that was not effectively eliminated by MAP30.

The traditional drug screening method of HBV in vitro is achieved by detecting viral antigen and HBV DNA secreted to culture medium. The covalently closed circular DNA, the template of HBV DNA, was hardly analyzed. This is mainly because of the tedious procedure of Southern Blot and the technical problems of real-time PCR. In our study, we analyzed HBV cccDNA in nuclei by Southern Blot. MAP30 was only found to be capable of inhibiting rcDNA and cccDNA molecules. On the other hand, MAP30 had no effect on the ssDNA. This is why the levels of total HBV DNA were found to be slightly down regulated, compared to the untreated controls. It is likely that this silent cccDNA may reactivate synthesis of viral transcripts and proteins and therefore a rebound of active viral replication. Therefore, elimination of cccDNA pool from infected cells still remains a challenge in HBV therapy.

Previous study showed that Hepatitis B virus replication is regulated by the acetylation status of Hepatitis B virus cccDNA-bound H3 and H4 histones [27]. In our study, MAP30 can inhibit the expression HBV antigen, decrease the replication of viral DNA, downregulate replicative intermediates and weakly reduced cccDNA. The higher dose of MAP30 was effective in suppressing viral replication by altering the kinetics of replicative DNA intermediates. This might be due to destabilization and degradation of cccDNA under high dose MAP30 pressure.

All these data might show that MAP30 exhibit its antiviral effects in several process during the of HBV replication. Total HBV pgRNA was not reduced after MAP30 treatment as determined by HBV-specific Northern blot analysis of total cellular RNA, since HBV pgRNA is the precursor or template of HBV replication, so the observed results with MAP30 is not due to inhibition of HBV mRNA and pgRNA synthesis but due to inhibition of HBV replication. The analysis of HBV replicative intermediates in HepG2.2.15 cells demonstrated a time-dependent, sequential synthesis of different viral DNA replicative intermediate species.

MAP30 may be active against both latent and lytic phases of the viral life cycle. MAP30 possesses dual ability to act on both DNA and RNA substrates. It has a novel DNA topological inactivation ability which converts supercoiled plasmid and viral DNA into topologitally inactive forms and interrupting DNA function. MAP30 also has an N-glycosidase activity that acts specifically on the glycosidic linkage between the ribosome and A4324 or G4323 of the 28 s rRNA in a cell-free system and inhibits in vitro eukaryotic protein biosynthesis. The ability of MAP30 to interrupt essential topological interconversions of viral DNA and ribosomal function of rRNA in viral-infected cells may provide novel mechanisms for its antiviral actions. The ability of MAP30 to act specifically on viral DNA and to interrupt its integration into host genome may provide novel mechanisms for its antiviral and antitumor actions.

In summary; the results showed the exposure of Hep2.2.15 cells to MAP30 resulted inhibition of HBV replication and antigen production in the supernatant. HBV DNA of intracellular replicative intermediates was decreased. However, the inhibition effect was not as strong as that of extracellular HBV DNA. Although further studies are needed to elucidate the molecular mechanisms, these results suggest that MAP30 could be a candidate for the therapy of Hepatitis B for developing an anti-HBV agent.

Copyright information

© Springer Science+Business Media B.V. 2007