Metabolic Brain Disease

, Volume 27, Issue 1, pp 59–65

Glutamate carboxypeptidase II gene polymorphisms and neural tube defects in a high-risk Chinese population

Authors

  • Hua Xie
    • Capital Institute of Pediatrics
  • Jin Guo
    • Capital Institute of Pediatrics
  • Jianhua Wang
    • Capital Institute of Pediatrics
  • Fang Wang
    • Capital Institute of Pediatrics
  • Huizhi Zhao
    • Capital Institute of Pediatrics
  • Chi Liu
    • Capital Institute of Pediatrics
  • Li Wang
    • Capital Institute of Pediatrics
  • Xiaolin Lu
    • Capital Institute of Pediatrics
  • Lihua Wu
    • Capital Institute of Pediatrics
  • Yihua Bao
    • Capital Institute of Pediatrics
  • Jizhen Zou
    • Capital Institute of Pediatrics
    • Capital Institute of Pediatrics
    • Capital Institute of Pediatrics
Original Paper

DOI: 10.1007/s11011-011-9272-8

Cite this article as:
Xie, H., Guo, J., Wang, J. et al. Metab Brain Dis (2012) 27: 59. doi:10.1007/s11011-011-9272-8

Abstract

Glutamate carboxypeptidase II (GCPII) catalyzes the hydrolysis of N-acetylaspartylglutamate into N-acetylaspartate and glutamate in the brain. Animal experiments suggested that GCPII plays an essential role in early embryonic development. Previous studies provided conflicting results on the effect of the GCPII rs61886492 C>T (or 1561C>T) polymorphism on NTDs. In the Lvliang area of Shanxi province, where the incidence of NTDs is the highest in China, a case–control study was conducted to investigate possible association between the GCPII rs61886492 and rs202676 polymorphisms and NTD risk. Results indicated all the case and control samples displayed the rs61886492 GG genotype. Although no significant differences in rs202676 genotype or allele frequencies were found between the NTD and control groups, the combined AG+GG genotype group was significantly associated with anencephaly (p = 0.03, OR = 2.11, 95% CI, 1.11–4.01), but not with spina bifida or encephalocele. Overall, the rs202676 A>G polymorphism is a potential risk factor for anencephaly. The results of this study suggest that phenotypic heterogeneity may exist among NTDs in this Chinese population.

Keywords

Neural tube defectsGCPIIPolymorphismAssociation study

Introduction

Neural tube defects (NTDs) form a group of severe congenital malformations, including anencephaly, spina bifida, and encephalocele, which develop when the neural tube fails to achieve proper closure during early embryogenesis. China has a high prevalence rate of NTDs, though the prevalence rates vary greatly among different regions. Shanxi Province is located in northern China and has the highest prevalence of NTDs in the country, with 105.5 per 10 000 births in 1987, (KZ 1989) and 138.7 per 10 000 births in 2003 (Li et al. 2006). A previous study found a rate of 199.38 per 10 000 pregnancies in the Lvliang area of Shanxi Province in 2002–2004 (Gu et al. 2007).

NTDs have a significant genetic component to their etiology, which interacts with specific environmental risk factors. Several studies have shown that periconceptional folic acid supplementation can prevent 50–70% of NTDs (Czeizel and Dudas 1992; Berry et al. 1999). A lot of polymorphisms in folate pathway genes have been intensively investigated and have shown an association with NTD risk in some studies (Barber et al. 2000; Botto and Yang 2000; Gueant-Rodriguez et al. 2003; Zhu et al. 2003). However, none of the known folate pathway gene variants has yet been implicated as a major determinant of NTDs risk.

The human glutamate carboxypeptidase II (GCPII) gene maps to chromosome 11p11.2. It has both folate hydrolase and N-acetylated-alpha-linked-acidic dipeptidase activity. Robinson et al. first described GCPII as an enzyme that catalyzes the hydrolysis of N-acetylaspartylglutamate (NAAG) into N-acetylaspartate in the brain, thereby releasing glutamate (Robinson et al. 1987). GCPII has been shown to both indirectly and directly increase the concentration of glutamate in the extra cellular space (Zhou et al. 2005). Several advances have indicated that glutamate could influence neural cell proliferation and differentiation(Cameron et al. 1998; Nakamichi 2011; Nguyen et al. 2001; Zhou et al. 2005). Han et al. reported early embryonic lethality in GCPII homozygous mutant mice, in which exons 1–2 and the 5′-UTR of GCPII were removed (Han et al. 2009). Tsai et al. knocked out the zinc ligand domain by deleting exons 9 and 10 of GCPII and found that mouse fetuses homozygous for the null mutation did not survive(Tsai et al. 2003). These studies suggest that GCPII plays an essential role in early embryonic development. The relevance of the rs61886492 polymorphism located in exon 13 of the GCPII gene has been investigated, but the results have been inconsistent. Afman et al. found that the variation was associated with increased plasma folate and had no effect on the risk of NTDs (Afman et al. 2003). However, Relton et al. reported that the variant appeared to exert a protective effect only in cases of anencephalic pregnancy (Relton et al. 2003). The rs202676 polymorphism lies in exon 2 of the GCPII gene, which has been studied mainly in tumors and has not yet been identified in NTDs.

Given the important role of GCPII in embryonic development, we tested the hypothesis that genetic polymorphisms in the human GCPII gene may modify NTD risk, using a case–control study of the Chinese population in the Lvliang area of Shanxi Province, which possess the highest rate of NTDs in China.

Methods

Subjects

The study was conducted in the Lvliang area of Shanxi Province in northern China, where the prevalence of NTDs is high. Stillborn NTD cases were obtained from nine county hospitals in the area from 2007 to 2009. Cases were medical abortions diagnosed with NTDs by B-mode ultrasound, in which the sex, gestational age, and the general development of the embryo were recorded in detail. A pathologic diagnosis of NTD was completed by experienced pathologists according to the International Classification of Disease, Tenth Revision, codes Q00 anencephaly, Q05 spina bifida, and Q01 encephalocele. Control subjects that were aborted for non-medical reasons were also enrolled from this region. Any embryos displaying pathologic malformations or intrauterine growth retardation were excluded from the control group. Routine prenatal checkup, questionnaire interview, and autopsy were completed for both control and case subjects. All the subjects were of Han ethnicity. Samples for DNA extraction were stored at −20°C in local hospitals before shipping on ice to the laboratories in Beijing. Nervous tissue (brain tissue and residues of brain tissue) was obtained from case and control subjects.

The study was approved by the local ethics committee, and written informed consent was obtained from the parents of all fetuses.

DNA extraction

Genomic DNA was extracted from frozen tissue samples using the Blood and Tissue DNA Kit (Qiagen, Germany) according to the manufacturer’s instructions, and was subsequently used for genotyping. The concentration and purity of the DNA were determined by absorbance at 260 and 280 nm.

Genotyping using direct sequencing

Genotyping was conducted by an experienced technician who was blinded to the diagnosis. Polymerase chain reaction (PCR) primers designed to amplify a fragment containing the polymorphic regions were based on the human GCPII genomic sequence. The primer sequences were: rs61886492, forward primer: TGTGAAGATGTGATGTCATA and reverse primer CAGGAAACTACACTCTGAGA; rs202676, forward primer ACTCCTGCTCTAAACCTCTGTAAT and reverse primer ATCTCGTTTACACCCATTAGTTG. The reactions for rs61886492 were carried out at 94°C for 10 min, followed by 35 cycles of 94°C for 20 s, 55°C for 15 s, and 72°C for 15 s, then 72°C for 10 min, and cooling to 4°C. The reactions for rs202676 were carried out at 94°C for 10 min, followed by 35 cycles of 94°C for 20 s, 57°C for 20 s, and 72°C for 30 s, then 72°C for 10 min, and cooling to 4°C. PCR products were subjected to direct sequencing using an ABI3700 sequencer (Applied Biosystems ). Sequencing results were exported to Mutation Surveyor version 3.25 (Softgenetics, State College, PA; http://www.softgenetics.com) for genotype analysis (Fig. 1). To ensure genotyping consistency, 10% of samples were re-genotyped.
https://static-content.springer.com/image/art%3A10.1007%2Fs11011-011-9272-8/MediaObjects/11011_2011_9272_Fig1_HTML.gif
Fig. 1

Partial sequences of amplified products containing SNP (rs202676 polymorphism) from 3 different genotypes as indicated. The sequences shown were sequenced using forward primers

Statistical analysis

The lifestyle and sociodemographic characteristics of case and control subjects were compared using χ2 tests for categorical variables. The Hardy-Weinberg equilibrium was also tested using χ2 tests. Differences in GCPII genotype/allele frequencies between case and control groups were tested using χ2 or Fisher’s exact tests. Odds ratio (OR) and 95% confidence interval (CI) were calculated to estimate the risks of NTDs related to the polymorphisms. Analyses were performed using R 2.11.0 (http://www.r-project.org/). All p values were two-sided, and p < 0.05 was considered to be significant.

Results

We identified 140 NTD cases and 163 controls using B-mode ultrasound. One case without NTD and three controls with histological evidence of intrauterine growth retardation or dysplasia were excluded after autopsy. A total of 136 (97.84%) cases and 157 (98.12%) controls were successfully genotyped for the rs61886492 polymorphism , and 134 (96.40%) NTD cases and 156 (97.50%) controls were successfully genotyped for the rs202676 polymorphism. Re-genotyping results showed 100% concordance. All of the 293 subjects genotyped for single nucleotide polymorphism (SNP) rs61886492 showed a homozygous GG genotype, and no further analysis of this polymorphism was performed.

Information on all of the subjects genotyped for rs202676 is shown in Table 1. Maternal age, sex of embryo, mother’s educational level, gravidity and periconceptional folic acid use were all similar between the case and control groups. The gestational week of controls was lower than that of cases because some pregnant women aborted for nonmedical reasons during early pregnancy. The levels of periconceptional folic acid usage were low in both groups: 9.0% in the NTD group and 8.4% in the control group.
Table 1

Characteristics of NTD and control groups

Characteristica

Controls (n = 156), n (%)b

Cases (n = 134), n (%)b

p

Mother’s age (years)

155

132

 

≤20

16 (10.32)

5 (3.79)

21–24

42 (27.10)

46 (34.85)

25–29

47 (30.32)

41 (31.06)

 

≥30

50 (32.26)

40 (30.30)

0.13

Mother’s education level

133

108

 

< high school

41 (30.83)

23 (21.30)

0.06

≥ high school

92 (69.17)

85 (78.70 )

Sex of offspring

123

112

 

male

44 (35.77)

42 (37.50)

 

female

79 (64.23)

70 (62.50)

0.79

Gravidity

126

17

 

1

33 (26.19)

51 (43.59)

0.06

2

53 (42.06)

45 (38.46)

≥3

40 (31.75)

21 (17.95)

Periconceptional folic acid usec

131

111

 

no

120 (91.60)

101 (90.99)

1.00

yes

11 (8.40)

10 (9.01)

Gestational week

155

132

 

<21

64 (41.29)

71 (53.79)

0.02

21–29

76 (49.03)

57 (43.18)

≥30

15 (9.68)

4(3.03)

aχ2 test was used to calculate the p values

b Percentages may not equal 100 because of rounding

c Periconceptional refers to the month before conception and the first 3 months after conception

No deviation from the Hardy-Weinberg equilibrium was found for rs202676 in the control and case groups (data not shown). The allele frequencies and genotype distributions showed no significant differences between the total NTD and control groups (Table 2). The associations between polymorphisms and three NTD subtypes were also computed. When heterozygous AG and homozygous GG genotypes were combined into a single group, the risk of anencephaly, but not for spina bifida or encephalocele, was significantly increased for the combined GG+AG genotype groups compared with AA genotypes (OR = 2.11, p = 0.03) (Table 3).
Table 2

GCPII rs202676 genotype and allele frequencies in NTD cases and controls

Genotype/allele

Cases (n = 134), n (%)a

Controls (n = 156) n (%)a

OR (95% CI)

pb

AA

57 (42.54)

77 (49.36)

 

0.44

GA

64 (47.76)

63 (40.38)

1.37 (0.84,2.24)

GG

13 (9.70)

16 (10.26)

1.10 (0.49,2.46)

A

178 (66.42)

217 (69.55)

 

0.42

G

90 (33.58)

95 (30.45)

1.16 (0.81,1.64)

aPercentages may not equal 100 because of rounding

bChi -square test was used to calculate the p-values

Table 3

Genotype frequencies of the GCPII rs202676 polymorphisms in the three subtype groupsa

Genotype

Control

Anencephaly

Spina bifida

Encephaloceleb

Total NTDs

 

(n = 156), n (%)

(n = 57), n (%)

(n = 62), n (%)

(n = 15), n (%)

(n = 134), n (%)

AA

77 (44.87)

18(31.57)

35 (56.45)

4 (26.67)

57

GA + GG

79 (50.64)

39 (68.42)

27 (43.55)

11 (73.33)

77

OR(95% CI)

 

2.11 (1.11, 4.01)

0.75 (0.42, 1.34)

2.68 (0.82, 8.78)

1.32(0.83,2.10)

p

 

0.03

0.37

0.11

0.29

aχ2 test was used to calculate the p values

bFisher’s exact test was used when the sample size was <5

The crystal structure of GCPII (PDB ID 3BI1), from the Research Collaboratory for Structural Bioinformatics Protein Data Bank, was also examined (Rose et al. 2011). Based on this structure, the molecular surface revealed using UCSF Chimera (Pettersen et al. 2004) software showed that residue Y75 was exposed at the surface (solvent accessibility: 50%) and joined with residue N76 (Fig. 2), which contacts the ligand. The G allele of rs202676 leads to the mutation Y75H, which could thus change the shape of the protein surface (from neutral to positive) and thus its binding potential.
https://static-content.springer.com/image/art%3A10.1007%2Fs11011-011-9272-8/MediaObjects/11011_2011_9272_Fig2_HTML.jpg
Fig. 2

Crystal structure of GCPII. The residue Y75 is marked in red, and residue N76, which contacts the ligand, is marked in blue. Both residues are exposed at the surface

We also analyzed data from previous studies and HapMap project data (www.hapmap.org) in terms of rs202676 genotypes, and found that the frequencies of the A and G alleles differed among different ethnic populations (Table 4).
Table 4

Genotype distribution and allele frequencies of the GCPII rs202676 polymorphisms in different populations

Population

Ref.

n

Genotype n (%)a

pb

Allele n (%)a

pb

AA

AG

GG

 

A

G

China (Shanxi)

This study

299

118 (39.46)

147 (49.16)

34 (11.37)

 

383 (64.05)

215 (35.95)

 

China (Beijing)

HapMap project

86

46 (53.49)

36 (41.86)

4 (4.65)

0.03

128 (74.42)

44 (25.58)

0.01

China (southeast)

Liu H et al (Liu et al. 2008)

517

222 (42.94)

228 (44.10)

67 (12.96)

0.37

672 (64.99)

362 (35.00)

0.37

Europe

HapMap project

226

130 (57.52)

82 (36.28)

14 (6.19)

<.001

342 (75.66)

110 (24.33)

<.001

Southwest USA

HapMap project

98

20 (20.41)

52 (53.06)

26 (26.53)

<.001

92 (46.93)

104 (53.06)

<.001

Houston (Texas)

HapMap project

176

46 (26.14)

98 (55.68)

32 (18.19)

0.01

190 (53.98)

162 (46.02)

<.001

Kenya

HapMap project

180

32 (17.78)

86 (47.78)

62 (34.44)

<.001

150 (41.67)

210 (58.33)

<.001

Italy

HapMap project

174

10 (5.75)

46 (26.43)

118 (67.82)

<.001

66 (18.97)

282 (81.03)

<.001

aPercentages may not equal 100 because of rounding

bChi-square test was used to calculate the p-values. Fisher’s exact test was used when the sample size was less than five

Discussion

NTDs are congenital malformations with various phenotypes and with no clearly identifiable cause. NTDs are multifactorial defects, which vary in severity depending on the type and level of the lesion (Finnell et al. 2003). This study of the associations between the rs61886492 and rs202676 GCPII gene polymorphisms and NTDs is the first such analysis in a Chinese population in the Lvliang area, which has the highest incidence of NTDs in China. Our analysis showed no significant association between the rs202676 polymorphism and total NTDs, but when NTDs were stratified into the three subtype groups, the combined AG+GG genotype group was significantly associated with anencephaly. These results suggest that GCPII rs202676 A>G is a potential risk factor for anencephaly. Anencephaly is a severe and common anterior defect caused by incomplete fusion of the cranial neural folds at the second closure site, leading to partial or total secondary brain degeneration (Finnell et al. 2003). Anencephaly represents a potentially more severe disease than spina bifida and encephalocele. The finding that the AG+GG genotype was significantly associated with anencephaly, but not with spina bifida or encephalocele, may have been the result of phenotypic heterogeneity and the small sample size. Relton et al. also reported phenotypic heterogeneity at a polymorphic level in NTDs (Relton et al. 2003). They showed that a protective effect of the T allele of MTHFR gene was observed in spina bifida occulta and anencephalic pregnancy, but not in others.

The development of the neural tube is a very complex process that involves cell change in shape, migration, and differentiation. Neurulation is a fundamental embryonic process that results in the formation of the neural tube, which forms by the shaping, folding and midline fusion of the neural plate. Interference of any of the sequential events of neurulation lead to NTDs. The GCPII gene catalyzes the hydrolysis of NAAG into N-acetylaspartate and glutamate. Glutamate was found to be expressed at early stages of development such as the neural plate and early neural tube, which suggested glutamate could have important functions (Lauder et al. 1986; Berki et al. 1995; Root et al. 2008). Glutamate has been reported to regulate neural precursor cell (NPC) proliferation, migration, and early differentiation and take on a positive regulator of neurogenesis (Nakamichi 2011; Nakamichi et al. 2009; Haydar et al. 2000; Luk et al. 2003; Powrozek et al. 2004; van den Pol et al. 1995; Schlett 2006). Subtle alterations in gene are likely to influence gene function. The common GCPII gene polymorphism, rs202676, has not previously been identified in NTDs. However, analysis of the crystal structure of GCPII revealed that the G allele leads to the mutation Y75H, which may affect contact between N76 and the ligand, potentially decreasing hydrolysis of NAAG and the release of glutamate. These suggested decreasing the release of glutamate might affect normal formation of neural tube. On the other hand, GCPII plays a role of folate hydrolase and is required for the uptake of folate. This polymorphism A>G may cause misregulation of folate absorption, resulting in low blood folate. Folate has been established as essential for development of the fetal central nervous system (Zhang et al. 2009a; Zhang et al. 2009b). Folate deficiency decreased neural stem cell (NSC) proliferation and affected apoptosis (Zhang et al. 2009a). The GCPII rs202676 A>G might disturb the development of neural tube by influencing the glutamate release and folate absorption, resulting in NTDs.

We also analyzed the genotype distribution of GCPII in normal populations based on the HapMap project data (www.hapmap.org). The genotype and allele frequencies of the Shanxi population in the current study were similar to those in southeast China, but differed from European, Japanese, Nigerian, American, and Italian populations, and even from the Chinese population in Beijing.

In conclusion, the GCPII rs202676 A>G polymorphism is a potential risk factor for anencephaly. The results of this study indicate that the influence of this polymorphism on different NTD phenotypes may differ in the high-risk population in the Lvliang area of Shanxi Province. However, the statistical power of the current study was limited by the relative rarity of the spina bifida and encephalocele subtypes, and further studies in larger cohorts are needed to clarify the relationship between GCPII polymorphisms and NTDs.

Acknowledgement

We are grateful to all the participants in this study, and we thank to all obstetricians in the local hospital at Shanxi Province, as well as the pathologists in the Department of Pathology for the diagnosis. We appreciate Dr Kunlin Zhang’s assistance for the analysis of protein crystal structure. We also thank all subjects and their family members for their cooperation in providing both clinical information and samples for the study.

The authors disclosed receipt of the following financial support for the research and/or authorship of this article: the Ministry of Science and Technology of the P. R. China, National “973” project on Population and Health (2007CB511901), National Natural Science Foundation of China (Project 81070491)

Copyright information

© Springer Science+Business Media, LLC 2011