Journal of Clinical Immunology

, Volume 30, Issue 1, pp 80–89

Foxp3+ Regulatory T Cells, Th17 Effector Cells, and Cytokine Environment in Inflammatory Bowel Disease

Authors

  • Nicola Eastaff-Leung
    • Department of Gastroenterology and HepatologyThe Queen Elizabeth Hospital
    • Discipline of PathologyUniversity of Adelaide
  • Nicholas Mabarrack
    • Discipline of Microbiology and ImmunologyUniversity of Adelaide
  • Angela Barbour
    • Discipline of PathologyUniversity of Adelaide
    • Department of Gastroenterology and HepatologyThe Queen Elizabeth Hospital
    • Discipline of MedicineUniversity of Adelaide
  • Simon Barry
    • Discipline of PediatricsUniversity of Adelaide
Article

DOI: 10.1007/s10875-009-9345-1

Cite this article as:
Eastaff-Leung, N., Mabarrack, N., Barbour, A. et al. J Clin Immunol (2010) 30: 80. doi:10.1007/s10875-009-9345-1

Abstract

Background

Inflammatory bowel disease (IBD) is thought to result from an aberrant immune response. Inflammation in IBD may be caused by the loss of homeostasis between CD4+ CD25high Foxp3+ regulatory cells (Treg) and proinflammatory Th17 cells. The aim of this study was to investigate Treg and Th17 cells in the peripheral blood and intestinal mucosa of IBD patients and to assess the mucosal cytokine environment.

Methods

Treg and Th17 cells were measured in peripheral blood of 63 IBD patients and 28 controls by flow cytometry. Forkhead box p3 (Foxp3), interleukin (IL)-17a, IL-1β, IL-6, IL-21, IL-23, and transforming growth factor (TGF)-β mRNA were analyzed using real-time reverse transcription polymerase chain reaction in intestinal biopsies of 24 IBD and 18 control subjects.

Results

A decrease in Treg and increase in Th17 cells was observed in the peripheral blood of IBD patients. When measured in the same patient and expressed as a ratio, a significant decrease in Treg/Th17 ratio was observed in IBD. Elevated expression of Foxp3, IL-17a, IL-1β, and IL-6 was observed in the mucosa of IBD patients, while TGF-β was only elevated in ulcerative colitis.

Conclusion

IBD is associated with a reduced ratio of Treg to Th17 cells in peripheral blood and is characterized by a proinflammatory cytokine microenvironment, which supports the continued generation of Th17 cells.

Keywords

Inflammatory bowel diseaseCrohn’s diseaseulcerative colitisregulatory T cellsTh17 effector cells

Introduction

Crohn’s disease (CD) and ulcerative colitis (UC) are the two main forms of inflammatory bowel disease (IBD). The pathogenesis of IBD is thought to originate from an aberrant immune response directed toward resident intestinal bacteria resulting in chronic inflammation [1]. The intestinal mucosa is normally maintained in a state of controlled inflammation in which an equilibrium exists between protective immunity and tolerance to self-antigen and commensal bacteria [2]. This tolerance is maintained by regulatory T cells (Treg), a population of CD4+ T cells that control immune responses in the gut by inhibiting the proliferation and effector functions of other T cells [3]. Treg are identified by expression of the high-affinity interleukin (IL)-2 receptor α-chain (CD25) [3]; however, CD25 is also upregulated on the surface of activated CD4+ T cells, so CD25 is not an exclusive marker for Treg [4]. Treg also express the transcription factor Forkhead box p3 (Foxp3), which is crucial for their development and function [5]. Although the mechanism through which Treg suppress proliferation of other T cells is not clear [6], there is evidence that they play an important role in preventing autoimmunity and controlling colitis and gastritis in vivo [3, 7]. The human disease immunodysregulation polyendocrinopathy and enteropathy X-linked syndrome (IPEX) is associated with loss of immunoregulation due to Foxp3 mutation [8, 9] and provides clear evidence for a role of Treg cells in health and disease in humans.

There is growing evidence that Treg and Th17 cells are linked from a developmental perspective, where the same naive T cell precursor pool that generates Treg cells is capable of generating IL-17a-producing CD4+ T helper (Th)17 cells [10, 11]. In murine models, transforming growth factor (TGF)-β drives the differentiation of naive T cells to a Treg phenotype, whereas Th17 cells are induced in the presence of IL-6 and TGF-β [10, 11]. In humans, the cytokine environment for the generation of Th17 cells is less certain as IL-6 and TGF-β alone are insufficient for the differentiation of human Th17 cells [12]. IL-1β, IL-6, TGF-β, IL-21, and IL-23 are implicated in promoting human Th17 differentiation, although the exact cytokine combination requires confirmation [1316].

Th17 cells express the transcription factor retinoic acid-related orphan receptor-γt (ROR-γt) and induce a range of proinflammatory mediators that bridge the innate and adaptive immune response enabling the clearance of invading pathogens [17, 18]. Although Th17 cells play a critical biological function in clearing extracellular pathogens [19], the inappropriate production of IL-17a by these cells is thought to contribute to the pathology of a range of inflammatory diseases. IL-17 expression is upregulated in the intestinal mucosa of IBD patients suggesting that a Th17-cell-driven immune response contributes to the pathology of IBD [20, 21]. The balance between Treg and Th17 cells may be essential for maintaining immune homeostasis, but no studies have yet examined this balance in IBD patients.

The aim of this study was to determine whether an imbalance of Treg and Th17 effector cells is characteristic of patients suffering from IBD. We not only investigated each cell type independently but also simultaneously compared the two cells types in the same patient subgroup. We hypothesized that any imbalance seen between these cell types may be driven by the cytokine microenvironment of the gut. We therefore investigated the expression of IL-1β, IL-6, IL-21, IL-23, and TGF-β in the intestinal biopsies of IBD and control patients.

Subjects and Methods

Subjects

IBD patients were recruited from the Department of Gastroenterology and Hepatology at The Queen Elizabeth Hospital (TQEH). Informed consent was obtained from all patients before collection of samples. This study was approved by TQEH Ethics of Human Research Committee and carried out according to the National Statement on Ethical Conduct in Research Involving Humans (1999) of the National Health and Medical Research Council of Australia and was in accord with the Declaration of Helsinki. Thirty-four CD, 29 UC, and 28 control patients were recruited for blood collection. All IBD patients were in clinical remission at the time of blood sampling based on clinical assessment and blood C-reactive protein levels (CRP < 10). Control subjects had non-inflammatory disorders (non-ulcer dyspepsia, reflux, constipation, etc.) or were healthy volunteers. All control subjects were screened for autoimmune disease markers (rheumatoid factor, anti-nuclear antibodies, anti-neutrophil cytoplasmic antibodies, and thyroid peroxidase antibodies). Intestinal biopsies were obtained from an additional subset of IBD patients in various states of disease activity. Biopsies were collected from 11 CD, 14 UC, and 18 control subjects at colonoscopy from non-inflamed tissue. Control subjects had non-inflammatory disorders or were undergoing colon cancer screening. Biopsy samples were collected and stored in RNAlater (Ambion, TX, USA) at −20°C to prevent RNA degradation prior to extraction.

Analysis by Flow Cytometry

Peripheral blood mononuclear cells (PBMCs) were isolated by density gradient centrifugation on Lymphoprep (Nycomed, Marlow, UK). In order to identify Treg cells, 1 × 106 PBMCs were surface labeled with a fluorescein isothiocynate (FITC) labeled anti-CD4 (BD Biosciences, NSW, Australia) and phycoerythrin (PE)–cyanine (Cy)5 labeled anti-CD25 antibodies (BD Biosciences, NSW, Australia). Surface labeling was followed by permeabilization with the Foxp3 fix/perm solution (eBioscience, CA, USA) and intracellular labeling with a PE conjugated anti-Foxp3 antibody (PCH101, eBioscience, CA, USA), according to the eBioscience Foxp3 staining protocol. PBMCs (2 × 106) used for IL-17a assays were stimulated for 5 h using 50 ng/mL of phorbol myristate acetate, PMA, (Sigma-Aldrich, MO, USA), and 1 μg/mL ionomycin (Sigma-Aldrich, St. Louis, MO) in the presence of 5 μg/mL brefeldin A (Sigma-Aldrich, MO, USA), at 37°C and 5% CO2. Cells were washed in PBS and surface-labeled with CD3-PE-Cy5, before fixing with 4% w/v paraformaldehyde solution and permeabilization with 0.1% w/v saponin solution. After permeabilization, all wash buffers contained 0.1% w/v saponin. Cells were blocked with 5% w/v non-fat dry milk powder solution in PBS/0.1% w/v saponin for 30 min then intracellular labeling performed with anti-IL17a−PE (clone ebio64DEC17, eBioscience, CA, USA). Flow cytometry was carried out using a BD FACScan, in which 300,000–500,000 events were collected, and lymphocytes were gated based on their forward and side light scatter properties. Data were analyzed with the Cell Quest analysis program (BD Biosciences, NSW, Australia). Absolute numbers of Treg cells and Th17 cells were calculated as the product of the total lymphocyte count from the routine complete blood examination (SA Pathology, South Australia, Australia) and target cell frequency of flow cytometric analysis.

Real-time PCR Analysis for FOXP3 and IL-17a Expression

Total RNA was isolated from intestinal biopsies using the RNeasy Lipid Minikit (Qiagen, Victoria, Australia). RNA gel electrophoresis was performed to assess RNA quality, and samples were accepted if 28S ribosomal RNA bands were present with intensity approximately twice that of the 18S RNA band. One microgram of RNA was reverse-transcribed to obtain complimentary DNA using Qiagen Quantitect Reverse transcription kit (Qiagen, Victoria, Australia). Primers were designed to span an intron of the genomic sequence. Beta actin forward primer: AAGAGCTACGAG CTGCCTGAC; beta actin reverse primer; GTAGTTTCGTGGATGCCACAG Foxp3 forward Primer: GAAACAGCACATTCCAGAGTTC, Foxp3 reverse primer: ATGGCCCAGCGGATGAG; IL-17a forward primer: CAATCCCACGAAAT CCAGGATG, IL-17a reverse primer: GGTGGAGATTCCAAGGTGAGG; IL-6 forward primer: AAATTCGGTACATCCTCGACGG, IL-6 reverse primer: GGA AGGTTCAGGTTGTTTTCTGC; IL-1β forward primer: CAGCTACGAATCTCCG ACCAC, IL-1β reverse primer: GGCAGGGAACCAGCATCTTC; IL-21 forward primer: CATGGAGAGGATTGTCATCTGTC IL-21 reverse primer: CAGAAATT CAGGGACCAA GTCAT; IL-23 forward primer: GGACAACAGTCAGTTCTGCTT, IL-23 reverse primer: CACAGGGCTATCAGGGAGC; TGF-β forward primer: CAAGCAGAGTACACACAGCAT, TGF-β reverse primer: TGCTCCACTTTTAACT TGAGCC.

Real-time reverse transcription polymerase chain reaction (RT-PCR) was carried out using a Corbett Rotorgene RG-3000 (Corbett Research, Australia), with two replicates per sample, a non-template control and non-reverse transcription control for each experiment. All reactions were carried out using SYBR green master mix (2×) solution (Applied Biosystems, CA, USA). PCR conditions for gene amplification began with a 10 min 95°C enzyme activation step, followed by 40 cycles of 95°C for 15 s and 60°C for 60 s. Expression of Foxp3, IL-17, IL-1β, IL-6, IL-21, and IL-23 mRNA was normalized to β-actin expression. Relative gene expression was calculated using the ΔCt method. Patient samples were omitted if the target gene was below detection levels. PCR products were purified using Qiaquick PCR purification kit (Qiagen, Vic, Australia), sequenced, and confirmed against the National Center for Biotechnology Information (NCBI) basic local alignment search tool.

Statistical Analysis

The statistical differences between IBD and the control group were evaluated using the two-tailed Mann–Whitney ranked sum test. Comparison of paired samples was carried out utilizing a paired samples t test. Data are expressed as mean ± standard error of the mean (SEM). Statistical significance was achieved when P < 0.05. Data were analyzed using Prism 4 software (GraphPad, CA, USA).

Results

Subjects

The average age ± SEM of CD, UC, and control patients that donated peripheral blood were 37.7 ± 2.8, 51.4 ± 4.0, and 46.8 ± 3.1 years, respectively. Of the total 63 IBD patients that donated blood samples, all were in a state of disease inactivity. Thirty-five received immunosuppressive treatment (azathioprine, 6-mercatopurine, methotrexate), four were prescribed with corticosteroids, 10 received 5-aminosalicylic acid, six were on a combination of immunosuppressive therapy, corticosteroids, and 5-aminosalicylic acid, and eight were not taking any medication.

Intestinal biopsy samples were collected from 25 IBD patients, and the average age ± SEM of CD, UC, and control patients were 40 ± 12.63, 61 ± 15.1, and 48 ± 14.8 years, respectively. Of the 25 IBD biopsies collected, 10 were from patients with moderate disease activity, seven had mild disease activity, and eight had inactive disease, based on global colonoscopic appearance and histologic reports (SA Pathology, Adelaide, South Australia, Australia). Eleven patients received immunosuppressive therapy, three received corticosteroids, six were prescribed a combination of immunosuppressive therapy, corticosteroids, and 5-aminosalicyclic acid, and five were not taking any medication.

CD4+ CD25bright Foxp3+Treg are Decreased in the Peripheral Blood of IBD Subjects

We defined the phenotype of Treg cells as CD4+ CD25bright Foxp3+ cells, as only CD4+ CD25bright T cells are consistently Foxp3 positive and highly suppressive, while CD4+ CD25intermediate T cells also include activated T cells that transiently express Foxp3 and are not suppressive [4]. In order to exclude contaminating CD25intermediate populations, a gate for the CD25bright population was set as the top 0.5% of CD4+ cells, capturing the highest expression of CD25 for all patient samples. Representative flow cytometric data demonstrate a high percentage of Foxp3+ cells residing with the CD4+ CD25bright gate with >85% of these cells shown to be Foxp3+ in a control patient, while only 40–60% of CD4+ CD25bright cells in representative IBD patients expressed Foxp3 (Fig. 1). The proportion of CD4+ CD25bright Foxp3+Treg cells among PBMCs ranged from 0.012% to 0.51% in CD patients, from 0.003% to 0.47% in UC patients, and from 0.121% to 0.55% in the control group. The absolute numbers of CD4+ CD25brightTreg (mean ± SEM per ml of whole blood) in the peripheral blood were found to be significantly lower in both CD patients (5.88 ± 0.6 × 103/mL, P = 0.002) and UC patients (5.16 ± 0.6 × 103/mL, P = 0.006) compared to the control group (8.08 ± 0.7 × 103/mL; Fig. 2).
https://static-content.springer.com/image/art%3A10.1007%2Fs10875-009-9345-1/MediaObjects/10875_2009_9345_Fig1_HTML.gif
Fig. 1

Detection of human Treg by flow cytometry. PBMC were stained with anti-CD4-FITC, anti-CD25-PECy5, and anti-Foxp3-PE. CD4+ CD25high gates were set to the highest 0.5% of CD25+, and cells within this gate were analyzed for Foxp3. Analysis of the CD4+ CD25high population in a representative control patient (a) revealed that approximately 85% of CD4+ CD25high cells were Foxp3+ (b), while in a representative CD patient, the CD4+ CD25high population (c) was only 62% Foxp3+ (d), and in a representative UC patient, the CD4+ CD25high population (e) was only 42% Foxp3+ (f)

https://static-content.springer.com/image/art%3A10.1007%2Fs10875-009-9345-1/MediaObjects/10875_2009_9345_Fig2_HTML.gif
Fig. 2

Quantification of Treg in IBD patients. Absolute numbers of Treg cells were calculated using lymphocyte counts, and the frequency of CD4+ CD25high Foxp3+ cells was determined by flow cytometry. Each datum point represents an individual patient sample. Median values for each group are represented by the horizontal line

Th17 Cells are Elevated in the Peripheral Blood of IBD Patients

Next, we measured the numbers of circulating Th17 cells in the peripheral blood by flow cytometry to determine if they were altered in IBD patients. In order to identify Th17 cells, we utilized their capacity to produce IL-17a upon stimulation [12]. Stimulation with PMA and ionomycin to trigger the production of IL-17a was found to rapidly downregulate CD4 in some patients, confounding the identification of Th17 cells (data not shown). An alternative T lymphocyte marker is CD3, which is also expressed by CD8+ T cells. Therefore, the ability of CD8+ T cells to produce IL-17a was evaluated, which revealed that less than 0.03% of CD8+ lymphocytes could produce IL-17a (data not shown). Therefore, it was possible to identify Th17 cells as CD3+ IL17a+ PBMCs. The proportion of Th17 cells among PBMCs in control subjects ranged from 0.10% to 0.49%, compared with 0.36–1.25% in CD patients and 0.31–1.66% in UC patients (Fig. 3). Absolute counts of Th17 are given in Fig. 4. Th17 cells were significantly higher in the blood of CD patients (15.0 ± 2.8 × 103/mL, P = 0.0012) and UC patients (13.4 ± 2.2 × 103/mL, P = 0.0169) compared with the control group (7.67 ± 0.80 × 103/mL).
https://static-content.springer.com/image/art%3A10.1007%2Fs10875-009-9345-1/MediaObjects/10875_2009_9345_Fig3_HTML.gif
Fig. 3

Detection of human Th17 cells by flow cytometry. PBMCs were stained with anti-CD3-PECy5 and anti-IL-17a-PE. In a representative control subject 0.2% of PBMCs were CD3+ IL-17a+ cells (a), while 1.2% of PBMCs in a representative CD patient were CD3+ IL-17a+ cells (b), and 1.9% of PBMC in a representative UC patient were CD3+ IL-17a+ cells (c)

https://static-content.springer.com/image/art%3A10.1007%2Fs10875-009-9345-1/MediaObjects/10875_2009_9345_Fig4_HTML.gif
Fig. 4

Quantification of Th17 cells in IBD patients. Absolute numbers of Th17 cells were calculated using patient lymphocyte counts, and the frequency of CD3+ IL-17a+ cells was determined by flow cytometry. Each datum point represents an individual patient sample. The horizontal line represents median values for each group

An Imbalance of Treg and Th17 Occurs in IBD

Having shown a decrease in Treg and concomitant increase in Th17 in IBD, this relationship was further explored by investigating the balance of Treg and Th17 within the same IBD patient and control subjects. To do this the numbers of Treg and Th17 cells in the peripheral blood of IBD patients were directly compared in the same individual. The balance of Treg and Th17 cells was assessed in 13 control, 15 CD, and 15 UC patients. While the numbers of Treg and Th17 cells were equivalent in controls, the balance of Treg and Th17 cells in the peripheral blood was disrupted in IBD patients (Fig. 5a). The imbalance observed was characterized by a decrease in Treg and an increase in Th17 cells in the peripheral blood of both CD (P < 0.0001) and UC (P = 0.004). For the subset of patients where both Treg and Th17 were enumerated using the same sample, the same defect was observed, and when expressed as a ratio of Treg to Th17 in the same patient (Fig. 5b) we observed near 1:1 Treg/Th17 in controls (0.8 ± 0.04), but lower ratios in both CD (0.55 ± 0.07) and UC (0.35 ± 0.05), p = 0.04 and 0.0002, respectively.
https://static-content.springer.com/image/art%3A10.1007%2Fs10875-009-9345-1/MediaObjects/10875_2009_9345_Fig5_HTML.gif
Fig. 5

a The balance of Th17 and regulatory T cell numbers is disrupted in IBD. Absolute numbers of CD4+ CD25high Foxp3+Treg and Th17 cells were determined using the same patient lymphocyte samples. b The ratio of Treg to Th17 is significantly decreased in CD and UC. Each datum point represents an individual patient sample. The horizontal line represents median values for each group

Expression of Foxp3 is Increased in the Intestinal Mucosa of IBD Patients

In order to determine if the balance of Treg and Th17 cells was also affected in the intestinal mucosa of IBD patients, mucosal biopsy samples were analyzed by real-time RT-PCR. This was done by measurement of the expression of the Treg specific transcription factor Foxp3 by real-time RT-PCR. A 10-fold increase in Foxp3 expression was observed in CD patients (P = 0.0007) compared to controls, while a 100-fold increase in Foxp3 expression was observed in UC patients (P < 0.0001; Fig. 6a). The expression of Foxp3 in UC patients was highest in those with moderate disease activity, lowest in those with mild disease activity, and variable in those with inactive disease. In contrast, the expression of Foxp3 was comparable among CD patients with mild, moderate, and inactive disease activity.
https://static-content.springer.com/image/art%3A10.1007%2Fs10875-009-9345-1/MediaObjects/10875_2009_9345_Fig6_HTML.gif
Fig. 6

RNA was extracted from intestinal biopsies with Foxp3 (a) and IL-17a (b) expression quantified by real-time RT-PCR and normalized to β-actin expression. The mucosal disease activity of individual patients is indicated by black circles representing patients with inactive disease, black squares representing mild disease activity, and white circles indicating patients with moderate disease activity. The horizontal lines represent the median values for each group

Expression of IL-17a is Increased in the Intestinal Mucosa of IBD Patients

In order to determine whether Th17 cell contribute to the maintenance of inflammation in the gut, the expression of IL-17a in the intestinal mucosa was measured by real-time RT-PCR. It was found that a 100-fold increase in IL-17a expression was observed in CD patients (P = 0.003) compared to controls, while a 1,000-fold increase in IL-17a expression was observed in UC patients (P = 0.01; Fig. 6b). Interestingly, UC patients with moderate disease activity were found to have the highest expression of IL-17a and were the same patients that had the highest expression of Foxp3, while the UC patients with mild disease activity that had previously been shown to express the lowest amounts of Foxp3 in the intestinal mucosa also expressed the lowest amounts of IL-17a. No difference was observed in the expression of IL-17a in CD patients of varying disease activities.

Increased Expression of IL-1β and IL-6 Within the Intestinal Mucosa of IBD Patients

The cytokine environment within the mucosa of patients with IBD may favor the generation of pathological Th17 cells [22]. The expression of the cytokines IL-1β, IL-6, IL-21, IL-23, and TGF-β within the intestinal mucosa of IBD and control patients was investigated. It was found that IL-1β was increased in both CD (P = 0.0032) and UC (P = 0.0005), and IL-6 was expressed at significantly higher levels in the mucosa of CD (P = 0.0007) and UC (P = 0.0032) patients (Fig. 7a, b). Expression of IL-1β and IL-6 in UC patients was highest in those with moderate disease activity, lower in those with mild disease activity, and variable in those with inactive disease. No correlation was seen in CD between disease activity and IL-1β or IL-6 expression. However, we found that high levels of IL-17a corresponded with high levels of IL-1β and IL-6 for both CD and UC patients.
https://static-content.springer.com/image/art%3A10.1007%2Fs10875-009-9345-1/MediaObjects/10875_2009_9345_Fig7_HTML.gif
Fig. 7

RNA was extracted from intestinal biopsies, and the expression levels of the cytokines IL-1β (a), IL-6 (b), and TGF-β (c) were determined by real-time RT-PCR and normalized to β-actin expression. The disease activity of individual patients is indicated with black circles representing patients with inactive disease, black squares representing mild disease activity, and white circles indicating patients with moderate disease activity. Horizontal lines indicate median values for each group

The expression of TGF-β was elevated in UC patients relative to control subjects (Fig. 7c; P = 0.048), but was unchanged in CD patients regardless of disease activity. Interestingly, a subgroup of UC patients with mild disease activity that had the highest expression of TGF-β also had low levels of IL-1β, IL-6, and IL-17a. However, those patients with moderate disease activity and high levels of TGF-β had the highest expression of IL-1β, IL-6, and IL-17. IL-21 was expressed at very low levels in both control and IBD patients (data not shown). There was no significant difference in the levels of IL-23 expressed in the intestinal mucosa of both IBD patients and controls (data not shown).

Discussion

In this study we have investigated Treg and Th17 cells in the peripheral blood of patients in quiescent IBD and also measured cytokine and Foxp3 mRNA in the intestinal mucosa. We have demonstrated a decrease of Treg and an increase in Th17 cells in the peripheral blood of IBD patients. Additionally, Treg and Th17 cells were measured in parallel in a subgroup of IBD and control subjects. Control subjects exhibited a near 1:1 ratio of Treg and Th17 cells in the peripheral blood, whereas a reduced ratio was observed in IBD patients indicating elevated Th17 cells concomitant with decreased Treg. Increased expression of IL-1β and IL-6 was demonstrated in the intestinal mucosa of IBD patients suggesting a proinflammatory microenvironment that may promote the development of Th17 effector cells [13, 16]. The elevated expression of the surrogate markers of Treg and Th17 cells, namely Foxp3 and IL-17a, was also observed in the intestinal mucosa of IBD compared to a control group.

Our study extends previous research on Treg in IBD using a refined approach to measure Treg by combining a stringent gating strategy for CD25high cells with intracellular staining for Foxp3. In addition, we measured Treg and Th17 cells from the same patient sample allowing for the first time direct comparison of regulatory and effector cell numbers. By measuring both Treg and Th17 cells, we identified that equilibrium exists between these cells in the control group, with a near 1:1 Treg/Th17 ratio. However, in IBD this balance is disturbed, with subjects demonstrating significantly higher Th17 cells and fewer Treg in the peripheral blood and hence a lower Treg/Th17 ratio. Interestingly, the balance between the numbers of Treg and Th17 cells is similarly perturbed in patients with juvenile arthritis, primary biliary cirrhosis, and coronary heart disease [2325], suggesting that this may be a characteristic feature of pathologic inflammatory disorders.

The decrease in Treg numbers in IBD is unlikely to be simply the result of immunosuppressive medication as evidenced by other studies. Infliximab has been reported to expand regulatory T cell numbers in children with CD [26]. Regulatory T cell numbers have been reportedly increased in myasthenia gravis patients after immunosuppressive therapy with prednisalone and azathoprine [27]. Treatment of multiple sclerosis relapse with methylprednisolone also demonstrated a rapid increase in Treg number immediately after treatment [28]. Decreased Treg numbers have been observed in patients treated with cyclosporine A [29]; however patients were omitted from the current study if they were prescribed this medication.

Previous work has shown increased numbers of Treg in the lamina propria and mesenteric lymph nodes of IBD patients [3032]. Our study found that in the intestinal mucosa of both CD and UC patients, Foxp3 was highly expressed, suggesting that Treg may be actively recruited to the intestinal mucosa in order to suppress proinflammatory immune responses. Activated T cells transiently expressing Foxp3 that do not exhibit suppressive activity may alternatively account for the high expression of Foxp3 in the intestinal mucosa [4]. However, previous studies have confirmed that Treg isolated from the gut associated lymphoid tissue of IBD patients are functionally suppressive ex vivo [32, 33], although the ability of Treg to regulate Th17 proliferation and effector activity may be limited in vivo due to a proinflammatory cytokine environment.

Recent research has demonstrated the plasticity of human Treg, with cells identified that express both ROR-γt and Foxp3, with the loss of suppressive function in the presence of high levels of IL-1β and IL-6 [34, 35]. Hence, the prolonged exposure of Treg to these inflammatory cytokines may not only paralyze their suppressive function but may also culminate in their conversion to Th17 cells [34, 35]. Our finding of decreased numbers of peripheral Treg cells and increased intestinal Foxp3 expression indicate a likely sequestration of Treg cells in the intestines of subjects with IBD. However in a cytokine microenvironment high in IL-β and IL-6, these Treg may not retain suppressive functions and if converted to producing IL-17 may even contribute to disease.

Investigation into the cytokine microenvironment in IBD revealed the elevated expression of IL-1β, IL-6, and IL-17a, which supports previous IBD studies that investigated these factors individually [3639]. Fujino et al. were the first to identify T cells as a source of IL-17 in IBD, with elevated number of IL-17+ T cells and serum IL-17 seen in IBD patients compared to controls. Elevated levels of IL-17a have also been reported in rheumatoid arthritis [40], multiple sclerosis [41, 42], asthma [43], and systemic lupus erythematosus [44]. We confirm an increase in Th17 cells in the peripheral blood and elevated IL-17a in the intestinal tissue of IBD patients. However, in conjunction with increased IL-17a, we also showed these patients expressed high levels of IL-1β and IL-6. Not only do IL-1β and IL-6 mediate a range of inflammatory immune responses but they are also linked to the development of Th17 cells [13, 16], and IL-6 additionally is capable of impeding Treg function [45, 46].

The exact requirements for human Th17 cell differentiation are unclear; however unlike mouse Th17 differentiation, IL-6 plus TGF-β is not sufficient for this process [12]. In humans, IL-1β and IL-6 are suggested to induce the production of IL-17 from memory T cells, while IL-21 and TGF-β may be required for the differentiation of Th17 cells from naive T cells [16]. Also IL-21 in combination with TGF-β may be a mechanism that frustrates the resolution of inflammation promoted by TGF-β in IBD [16]. However, we were not able to confirm this as the expression of IL-21 was low or undetectable in the mucosa of IBD patients and those of control patients. Signaling through IL-21 may still be involved in IBD, with high levels of IL-21R found in the intestinal biopsies of IBD patients, suggesting that IBD patients may be sensitive to low levels of IL-21 in the intestinal mucosa [47]. IL-23 is believed to be required for the maintenance of Th17 cells [4850], although we did not detect an increase in IL-23 in IBD. Signaling through IL-23 however may also play a role in IBD, as genome-wide association studies have identified polymorphisms in the IL-23 receptor (IL-23R) in both CD and UC, and increased expression of IL-23R has previously been shown in both CD and UC [49, 51, 52]. Previous studies have reported elevated IL-21 and IL-23 in resected specimens from IBD patients [51, 53]. The inability to detect variations in both IL-21 and IL-23 may reflect assay sensitivity as small biopsy samples were used in this study rather than whole resected tissue.

Our investigation into the cytokine microenvironment of IBD also revealed an increase in TGF-β expression in UC patients, but not in CD. Defective TGF-β signaling has been shown in animal models of IBD [54] and increased TGF-β1 seen in UC but not CD [55]. TGF-β is involved in both Treg and Th17 development and its function may be context dependant. Animal models have demonstrated that at high levels of TGF-β, Foxp3 expression is upregulated and Treg differentiation is induced, whereas at low levels of TGF-β, IL-6 and IL-21 synergize to promote the differentiation of Th17 cells [56]. Indeed our findings support this with UC patients exhibiting the highest TGF-β levels concomitantly expressing low levels of IL-17a, in contrast to those with intermediate TGF-β expression that expressed high levels of IL-17a.

In summary, we have demonstrated elevated numbers of Th17 cells combined with decreased Treg numbers in the peripheral blood in IBD. In addition, Foxp3 and IL-17a expression was increased in IBD intestinal mucosa. We suggest that this indicates the sequestration of Treg to the gut where a proinflammatory cytokine environment high in IL-1β and IL-6 restricts Treg activity and promotes the continual differentiation and development of Th17 cells. We propose that Treg and Th17 cells remain in a state of balance within the immune system in health, with changes in the cytokine microenvironment promoting or suppressing the development of Treg and Th17 cells. Current broad-spectrum immunosuppressive therapies potentially leave IBD patients susceptible to cancer or infection. New therapeutic approaches that specifically target Th17 effector cells and/or the cytokines that promote their development, such as IL-1β and IL-6, may provide more focused treatment strategies for the management of IBD. Hence, therapeutic approaches that aim to re-establish homeostasis by increasing the number of Treg, while also controlling effector T cell populations, may prove effective in the treatment of IBD. In addition, the imbalance demonstrated in the peripheral blood of IBD patients may provide new options of a non-invasive diagnostic tool. The initiating events that lead to a proinflammatory cytokine environment will now need to be further investigated.

Copyright information

© Springer Science+Business Media, LLC 2009