Familial Cancer

, Volume 9, Issue 2, pp 141–150

An Ashkenazi founder mutation in the MSH6 gene leading to HNPCC

  • Yael Goldberg
  • Rinnat M. Porat
  • Inbal Kedar
  • Chen Shochat
  • Daliah Galinsky
  • Tamar Hamburger
  • Ayala Hubert
  • Hana Strul
  • Revital Kariiv
  • Liat Ben-Avi
  • Moran Savion
  • Eli Pikarsky
  • Dvorah Abeliovich
  • Dani Bercovich
  • Israela Lerer
  • Tamar Peretz
Article

DOI: 10.1007/s10689-009-9298-9

Cite this article as:
Goldberg, Y., Porat, R.M., Kedar, I. et al. Familial Cancer (2010) 9: 141. doi:10.1007/s10689-009-9298-9

Abstract

Mutations in DNA mismatch repair genes underlie lynch syndrome (HNPCC). Lynch syndrome resulting from mutations in MSH6 is considered to be attenuated in comparison to that caused by mutations in MLH1 and MSH2, thus more likely to be under diagnosed. In this study we report of a common mutation in the MSH6 gene in Ashkenazi Jews. Genetic counseling and diagnostic work-up for HNPCC was conducted in families who attended the high risk clinic for inherited cancer. We identified the mutation c.3984_3987dup in the MSH6 gene in 19 members of four unrelated Ashkenazi families. This mutation results in truncation of the transcript and in loss of expression of the MSH6 protein in tumors. Tumor spectrum among carriers included colon, endometrial, gastric, ovarian, urinary, and breast cancer. All but one family qualified for the Bethesda guidelines and none fulfilled the Amsterdam Criteria. Members of one family also co-inherited the c.6174delT mutation in the BRCA2 gene. The c.3984_3987dup in the MSH6 gene is a mutation leading to HNPCC among Ashkenazi Jews. This is most probably a founder mutation. In contrast to the c.1906G>C founder mutation in the MSH2 gene, tumors tend to occur later in life, and none of the families qualified for the Amsterdam criteria. c.3984_3987dup is responsible for 1/6 of the mutations identified among Ashkenazi HNPCC families in our cohort. Both mutations: c.3984_3987dup and c.1906G>C account for 61% of HNPCC Ashkenazi families in this cohort. These findings are of great importance for counseling, diagnosis, management and surveillance for Ashkenazi families with Lynch syndrome.

Keywords

HNPCC BRCA MSH6 Founder Ashkenazi MMR 

Abbreviations

AC

Amsterdam criteria

BC

Breast cancer

CRC

Colorectal cancer

DHPLC

Denaturing high performance liquid chromatography

HBOC

Hereditary breast ovarian cancer

HNPCC

Hereditary non-polyposis colorectal cancer

IHC

Immunohistochemistry

MMR

Mismatch repair

MSI

Microsatellite instability

Introduction

Hereditary non-polyposis colorectal cancer (HNPCC)/lynch syndrome—MIM 114500) is caused by a germline mutation in one of the mismatch repair (MMR) genes (MLH1, MSH2, MSH6, PMS1, PMS2). Traditionally, screening for HNPCC has relied on examination of family history and other clinico-pathologic criteria, as per the Amsterdam Criteria [4]. Adding the Bethesda guidelines to the diagnostic process allowed the identification of more individuals likely to have HNPCC [16, 21].

Lynch syndrome of the MSH6 type mostly produces an attenuated phenotype, probably because of the partial compensation provided by the MSH3 protein. The cancers in patients with germline mutations in MSH6 tend to occur later in life; therefore, the term “attenuation” is a reference to age of onset, but not the eventual prevalence of cancer [10]. By age 70, 71% of women with MSH6-type Lynch syndrome will have developed endometrial cancer. Colorectal cancer (CRC) is as penetrant in this disease as in the classic forms, but tends to occur later in life (mean age 56 years) than in classic lynch syndrome [10]. Mutations in MSH6 account for about 10% of all of the disease-causing mutations reported in the database of the international society for gastrointestinal hereditary tumours (InSiGHT) (http://www.insight-group.org/mutations). The delayed age of onset could result in under diagnosis of MSH6 mutation carriers. Indeed, it has been recently reported to occur more often; For example, among the Danish lynch syndrome population, MSH6 plays a significant role and accounts for 22% of all mutations [13].

The MMR gene mutation spectrum may vary across different populations and be influenced by founder mutations that prevail in specific ethnic groups. Elucidation of the spectrum of HNPCC-related gene mutations in defined ethnic groups can improve the diagnostic process allowing it to be more focused and efficient. In certain populations, founder mutations explain a substantial fraction of HNPCC. Examples of founder mutations in the MMR genes include the following: In Finland, two mutations in MLH1 (a 3.5-kb genomic deletion including exon 16, and c.454-1G>A), account for 63% of all disease-causing mutations identified in families with HNPCC [14, 12]. Founder mutations in MSH2 include c.942 + 3A>T in Newfoundland, c.1452_1455delAATG in the Southern region of China [3] and the 16 kb deletion of MSH2 in the United States [11].

The MSH2 c.1906G>C (p.Ala636Pro) mutation was described as a founder mutation among Ashkenazi Jews [5]. The mutation was reported only among individuals of Ashkenazi origin and was associated with an extended haplotype that is common in this population [18]. The MSH2 c.1906G>C mutation was shown to be rare among the general Ashkenazi population, yet highly penetrant, leading mainly to colorectal cancer. Most of the families with the c.1906G>C mutation fulfilled the Amsterdam criteria (AC). We and others [7, 8], have detected this mutation in 18–33% of Ashkenazi AC positive families. Lately we reported of an Ashkenazi family with childhood cancer syndrome (CCS) due to homozygosity of this mutation [20].

We have previously described a broad spectrum of mutations responsible for HNPCC in a cohort of patients in Israel, including the c.3984_3987dup (reported as C.3987_3988insGTCA) in the MSH6 gene in one family (Goldberg et al 15). This mutation has been previously reported in a Jewish family [15], and in a Dutch patient [10]. One other case was described by [9]. The mutation is a 4 bp duplication in exon 9, results in a frameshift starting at codon 1330 and creates a termination codon at codon 1341 (p.Leu1330ValfsX12). It was shown to be associated with loss of expression of the MSH6 protein in the tumor tissue [7, 15].

Here we report this mutation in four unrelated Ashkenazi families. We describe 25 carriers of the mutation (19 carriers and 6 obligate carriers). In one of the families, two of the carriers were also carriers of the c.6174delT founder mutation in the BRCA2 gene. Three of these families qualified with the Bethesda Guidelines, but none fulfilled the Amsterdam criteria, but.

Materials and methods

Patients

Patients were referred to the Onco-Genetic Service in Hadassah Medical Center, and interviewed by a board certified medical geneticist. Pedigrees of three or more generations were drawn. Patients were offered further genetic testing, guided by clinical parameters. All four families reported here are of Ashkenazi origin.

Family A (Fig. 1a; Table 1)—we have reported this family elsewhere [7]. The proband (II-2) has a history of four primary malignancies. It is of note that she got Tamoxifen after diagnosed with Breast cancer. The proband has two healthy children. One of them inherited the mutation.
Fig. 1

Pedigrees of the four HNPCC families described in the paper

Table 1

Summary of HNPCC family members reported in this paper

FN

BC#

G

YOB

MSH6 status

BRCA status

Family risk AC/Bethesda

Polyps (ages)

Tumors reported (age)

A

I-1

F

 

ND

ND

  

Endometrium (79)

II-2

F

1940

Positive

Negative

No/yes

 

Breast (60), Endometrium (62), CRC (65, 66)

III-1

M

1967

Negative

    

III-2

F

1972

Positive

ND

   

B

I-1

M

 

ND

ND

No/no

 

Urothelial (60)

II-1

F

 

Positive

ND

  

Breast (40), Urothelial (55)

II-2

M

1947

Negative

Negative

   

C

II-1

F

 

ND

ND

No/yes

 

CRC (60)

III-1

M

 

ND

ND

  

CRC (50)

III-2

F

 

ND

ND

  

CRC (40)

IV-1

F

1971

Positive

Negative

   

D

I-1

M

 

Positivea

    

I-2

M

 

Positivea

   

Breast (80)

I-3

F

 

Negative

Positivea

   

II-1

F

1929

Positive

Negative

  

Ovary (57), Endometrium (57), CRC (65), Gastric (72)

II-2

F

1922

Negative

   

CRC (68)

II-3

M

1917

Positive

Positive

No/yes

70

CRC (76)

II-4

F

     

Breast

II-5

M

 

Positivea

   

BCC (80)

II-6

      

CRC

II-7

M

 

Positivea

   

CRC (80), bladder (80)

II-8

      

Endometrium

II-9

M

 

Positivea

   

Bladder (60)

III-2

M

1950

Positive

  

42

 

III-3

F

1952

ND

Positive

  

Breast (<60)

III-4

F

1956

Positive

Positive

   

III-5

F

1966

Negative

Negative

   

III-7

M

1950

Positive

Negative

  

Meningioma (58)

III-8

F

 

ND

ND

  

Breast (38)

III-10

M

 

Positivea

   

Bladder (55)

III-11

M

1947

Positive

    

III-12

M

1951

Negative

    

III-13

M

1953

Negative

Negative

   

III-14

M

1958

Positive

Negative

   

III-15

F

1961

Negative

Negative

   

III-16

M

1964

Negative

Negative

   

IV-1

M

1973

Positive

    

IV-2

M

1976

Positive

    

IV-3

F

1980

Positive

    

IV-4

M

1987

Positive

    

IV-5

F

1979

Positive

    

IV-6

M

1980

Positive

    

IV-7

M

1983

Negative

    

IV-8

M

1985

Negative

    

IV-9

M

1972

Negative

Negative

   

IV-10

F

1984

Positive

    

IV-11

M

1987

Negative

    

AC Amsterdam criteria, CRC colorectal cancer, G gender; YOB year of birth

aObligate carrier

Family B (Fig. 1a; Table 1)—the healthy proband (II-2) was referred to the high risk clinic due to positive family history. His father was diagnosed with bladder cancer at the age of 60. His sister (II-1) was diagnosed with breast cancer (BC) (40) and urothelial cancer (55), and was found to be a carrier of the mutation.

Family C (Fig. 1a; Table 1)—the 38-year-old healthy proband (IV-1) was referred to the high risk clinic due to positive family history. She underwent colonoscopy which was normal. Though she has delivered the genetic information to her family members, no other family members were willing to undergo genetic work-up so far.

Family D (Fig. 1b; Table 1)—the proband (II-3) was diagnosed with moderately differentiated adenocarcinoma of the ascending colon, stage 2B, aged 76. It was accompanied by one tubular adenoma. Of his three daughters, one had a prior diagnosis of BC and tested positive for the c.6174delT mutation in BRCA2.

Testing algorithm

Genetic counseling is offered to patients with high risk for malignancy. Genetic testing is offered based on clinical suspicion. Written informed consent according to the Genetic Testing Act (2000) are obtained from all tested patients. Ashkenazi patients with a personal or family history of breast–ovarian cancer are offered testing for the common Ashkenazi mutations in BRCA1&2. Patients who comply with the revised Bethesda guidelines are offered genetic testing for HNPCC, regardless of their BRCA status. Ashkenazi Jews suspected for HNPCC are first tested for the c.1906G>C founder mutation. If tested negative we proceed with tumor testing for microsatellite instability (MSI) and Immunohistochemistry (IHC) for MLH1, MSH2 and MSH6 proteins.

Tumor testing

Tumor tissue was obtained from archived paraffin blocks. Normal and pathological tissue of the colon were differentially marked on the slide. DNA extraction from the paraffin embedded tissues was performed as described [2]. DNA was extracted from peripheral blood lymphocytes using the QIAGEN DNA Isolation kit (QIAGEN, Germany).

Microsatellite instability analysis was performed by a fluorescence-based PCR method as described, [6]. PCR products were analyzed on ABI Sequencer (3100) using GeneScan and Genotyper software (PE Applied Biosystems).

Immunohistochemistry analysis—was preformed as described previously [7]. Briefly 5 μM paraffin sections were de-waxed and hydrated through graded ethanol, antigen retrieval was done in 20 mM citrate buffer pH 6.0 (hMSH2) or with Borg Decloaker (Biocare Medical) pH 9.5 (hMLH1 and hMSH6) in a pressure cooker (Biocare Medical). Slides were incubated with the indicated primary antibody, diluted 1:50 in CAS-Block (Zymed) overnight at 4°C, washed with Optimax (biogenex), incubated with MACH 3 Mouse HRP Polymer (Biocare Medical) and developed with DAB. Normal cells showing nuclear staining for the MMR proteins were used as an internal positive control. Mouse monoclonal antibodies used: hMLH1: clone G168-15; hMSH2: clone FE11; hMSH6: clone BC/44 all from Biocare Medical.

Mutation screening of the MMR genes was performed as described previously [7] using a combination of denaturing high performance liquid chromatography (DHPLC) and semiquantitative fluorescent multiplex–PCR analysis. Primers for PCR were designed from multiple databases to contain the exons and at least 30 bp of intron flanking regions. Fragments with abnormal chromatography patterns were sequenced bi-directional.

The Ashkenazi Jewish mutation c.1906G>C in MSH2 was tested by allele specific amplification, as described in [7].

The c.3984_3987dup mutation in MSH6 was tested by allele specific amplification using the primers: MSH6ex9F-5′-AGGCTTGCTAATCTCCCAGA-3′ and c.3987ins4ARMSr-5′-CCGAAATAATCGTAGTGACTGACAG-3′. The PCR product of the mutant allele is 100 bp.

PCR conditions: 94°C—20 min; 35 cycles of 94°C—30 s; 61°C—1 min; 72°C—1 min; final extension 20 min 72°C. PCR products run on 3% NuSieve-Agarose gel (FMC-CAMBREX) in TBE buffer, stained with ethidium bromide and visualized under UV illumination.

The analysis of the BRCA founder mutations was performed as previously described [1].

Haplotype analysis

The MSH6 gene resides on chromosome 2 (47,863,725-47,887,596 bp). Dinucleotide rich sequences located on both sides of the MSH6 gene (200 and 100 kb) were selected for haplotype analysis (Table 2). The sequences obtained by utilizing the UCSC genome browser (http://genome.ucsc.edu/cgi-bin/hgTracks). An intragenic SNP (A/G, rs1800932) in exon 2 was included in the haplotype. This SNP was detected through the sequencing screening and in all family members was analyzed by digestion with the enzyme MspI. Allele A related to the uncut fragment (335 bp) while the PCR product of the G allele was cut to 260 bp. Primers for microsatellite analysis were designed using Primer 3 software (http://primer3.sourceforge.net/).
Table 2

Primers sequences and location, used for haplotype analysis

Primer name

Primer sequence 5′–3′

PCR length (bp)

Sequence location on chromosome 2 (Mb)

19ACf

19ACr-FAM

GCAAATAGGTACGGCCTCTC

CCAACTGGTTCCATTTGACC

~160

47,654,549–47,654,587

25TGf

25TGr HEX

CTGTTCAGCTGCTCTCTGGTT

TTATCACCCCAGCCAGACTC

~180

47,658,044–47,658,093

MSH6Exon 2F

MSH6Exon 2R

CTGCCTTTAAGGAAACTTGA

AGTCTGCCTGTCTGTCTGTT

335

47,871,510–47,871,844

20CAf

20CAr FAM

GACAATGGTGGTTACCAGAC

TACTCTCCGTCTCCTAGTGG

~190

47,985,245–47,985,285

The primers’ name was according to the number of repeats shown in the USCS database. Amplification of exon 2 and MspI digestion performed to detect SNP rs1800932

Standard PCR performed, annealing temperature was 58°C and PCR products were analyzed on the ABI Sequencer (3100) using Genemapper software.

Results

The c.3984_3987dup has been identified in four unrelated Ashkenazi families. In each family the index case was identified by DHPLC and sequencing. For diagnosis of other family members allele-specific PCR was designed. We have tested 31 members of the four families, and identified 19 carriers (10 males and 9 females) of this mutation, six additional family members are obligate carriers. In one family, two carriers also co-inherited the c.6174delT mutation in the BRCA2 gene. The clinico-pathological features of the cancers, demographics, family histories of the probands and their genetic status are shown in Fig. 1 and Table 1.

Three of the four families qualified for the Bethesda guidelines, but none qualified with the AC, mainly due to relative late onset of disease. CRC was diagnosed in 4/25 (16%) of carriers. The earliest diagnosis was at the age of 57. One of the carriers however, had an adenoma removed at the age of 42. Tumors of the urinary system are reported in four carriers (Table 1). Endometrial and ovarian carcinomas were reported in two females, the earliest age to be reported was 57. The risk for malignancy was 33% by the age of 60, 62% by the age of 75, and by the age of 80 it reached 84%. BC is reported in six women of the four families. One of the six is a carrier for a BRCA mutation. Two of the six were found carriers for the MSH6 mutation.

Family D—the proband (II-3) is one of eight siblings. Two of his brothers were diagnosed with colon cancer at age 70. One of them and an additional brother were diagnosed with renal carcinoma. One sister was diagnosed with endometrial cancer whereas a second sister was diagnosed with BC. The mother of the proband (I-3) was diagnosed with BC at the age of 80.

A diagnosis of breast cancer followed by confirmation of BRCA2 c.6174delT carrier status in the probands’ daughter, prompted BRCA testing of the proband and nuclear family. The proband was also found to be carrier of the c.6174delT mutation. He was tested negative for the Ashkenazi mutations in the BRCA1 gene. Incorporation of clinically relevant oncological family history indicated that the probands’ family had an increased incidence of several malignancies unexplained by the presence of a BRCA mutation; while carcinoma of the breast, ovary and colon can be attributed to BRCA carrier status, malignancies such as renal cell carcinoma and uterine carcinoma cannot. It appeared that the proband inherited the BRCA2 mutation from his mother, and MSH6 mutation from his father.

We report 20 carriers from family D. Five of them are obligate carriers. Note that two obligate carriers reached the age of 70 with no diagnosis of cancer. Only two members of the family co-inherited both, a mutation in BRCA2 and in MSH6. Interestingly, one of family member (II-2) who was affected with colon cancer (68) was tested negative for both mutations.

Tumor testing was done on colon carcinoma from two cases (family D II-3) and (family A II-2). MSI exhibited a high degree of instability. IHC illustrated normal expression of MSH2 and MLH1 but absent expression of MSH6 in tumors from both patients (Fig. 2A, Bb). Interestingly, patient II-2 from family A also had breast tumor. The breast tumor was microsatellite stable and expressed all three MMR proteins (Fig. 2Bc, d).
Fig. 2

Tumor testing (A, B). A Family D; case II-3: colonic tumor cells illustrate normal expression of MSH2 and MLH1 (up and middle) and absent expression of MSH6 (bottom). B Family A; case II-2: immunohistochemistry against MSH6 demonstrates that MSH6 is expressed in normal colon (a), whereas the CRC tumor cells do not show expression of MSH6 (b). On the other hand, both the normal breast (c) and the breast tumor cells (d) exhibited expression of MSH6 protein. T denotes tumor region while N denotes non-neoplastic epithelium

Prevalence of mutation among high risk Ashkenazi Jews

We have identified 23 Ashkenazi families with HNPCC by now. Four (17%) of them harbored the c.3984_3987dup mutation.

The c.3984_3987dup was tested in 66 Ashkenazi families that qualified for the BT guidelines, and was detected in 3/66 (4.5%) of them. The mutation was not detected in any of 13 Ashkenazi families who fulfilled the AC. None of the patients tested co-inherited the c.3984_3987dup and c.1906G>C founder mutation in MSH2.

Haplotype analysis

The fact that the c.3984_3987dup mutation was found in four unrelated Ashkenazi families raises the possibility that this is a founder mutation. In order to support this idea we investigated the haplotypes associated with the mutation. The haplotype associated with the c.3984_3987dup mutation was constructed based on the microsatellite sequences (19AC, 25TG and 20CA) located ~300 kb in the proximity of the MSH6 gene and the intragenic SNP rs1800932 (Fig. 3). In family D all carriers, except 2 individuals have the same haplotype (19AC-167 bp, 25TG-182 bp, SNP G and 20CA-196 bp). Individuals II-3 and III-4, father and daughter, have a different haplotype, where the distal marker is 192 bp. In family C only one patient was available, thus, a haplotype could not be constructed, however he shared alleles with most of the carriers in each of the three polymorphic loci (161 bp, 167 bp for 19AC, 182 bp, 186 bp for 25TG and 182 bp, 196 bp for 20CA). In family A the mother and her daughter carry the mutation and the son does not, thus, the normal haplotype of the mother is 163 bp-182 bp-A-188 bp (19AC-25TG-SNP-20CA) and the haplotype associated with the mutation is 163 bp-180 bp-G-196 bp.
Fig. 3

Haplotype analysis. Haplotypes were constructed using microsatellite sequences (19AC, 25TG and 20CA) allocated ~300 kb in the proximity of the MSH6 gene and an intragenic SNP (A/G, rs1800932). Grey symbols: carriers

Discussion

This report presents a common mutation among Ashkenazi Jews who present with features suspicious for HNPCC.

The c.3984_3987dup mutation in the MSH6 gene has been previously described as a disease causing mutation four times [7, 9, 10, 15], at least two of them among Ashkenazi. We now report this mutation in 25 (19 carriers and 6 obligate carriers) individuals from four Ashkenazi unrelated families. Altogether this mutation has been reported in five apparently unrelated Ashkenazi families.

The mutation c.3984_3987dup was not reported as a common mutation, thus, if exists in other populations it is probably rare, supporting the view that this is a founder mutation in the Ashkenazi population. However, based on polymorphic dinucleotide repeats, there are variations in the haplotype associated with the mutation between the families and within the same family. Two haplotypes were found in family D (167 bp-182 bp-G-196 bp and 167 bp-182 bp-G-192 bp) and another haplotype was found in family A (163 bp-180 bp-G-196 bp). Allele G of SNP rs1800932 was associated with the mutation in all carriers. It is of note that the frequent allele in various populations is A and the frequency of the G allele is between 0.10 and 0.34 (www.ncbi.nlm.nih.gov/SNP/snp).

With the reservation that the number of the informative individuals is limited, we favor the assumption that the mutation c.3984_3987dup is indeed a founder mutation and the variation in the haplotype is due to excess of recombination and/or mutations as a result of the high mutator phenotype due to a mutated MSH6 mutation. Alternatively, the mutation c.3984_3987dup is a recurrent mutation, if so, why among Ashkenazi Jews only?

The c.3984_3987dup mutation is located in exon 9 resulting in a stop codon in exon 10, the most 3′ exon of MSH6. Although, unexpected, due to its distal location, this mutation abolishes MSH6 protein expression as was demonstrated by the immunohistochemistry staining in two colon carcinomas (Fig. 2). Absence of MSH6 expression and MSI associated with the c.3984_3987dup mutation is reported also in two of the previous reports of this mutation [10, 15]. These results confirm the pathogenicity of the mutation.

Lynch syndrome of the MSH6 type mostly produces an attenuated phenotype, indeed, the families we describe fulfill the Bethesda guidelines, but none qualified with the AC. In line with previous reports, tumors tend to occur later in life; the average age at first HNPCC related tumor among carriers is 61 years. By age 70, 66.6% of carriers have developed cancer. Tumor spectrum included colon, gastric, ovarian endometrial, urinary cancer. Two of the women carriers had four primary tumors and 25% of them have developed endometrial cancer. It is less than usually reported among MSH6 families, however, one of the carriers who co-inherited the BRCA mutation, had preventive hysterectomy and oophorectomy, and five other women are younger than 40.

Mutations in BRCA are responsible for 40–50% of ovarian tumors among Ashkenazi women. BRCA testing was negative in the one woman who was a carrier of HNPCC and had ovarian cancer. BC is reported in six women from the four families tested. Two of them are BRCA carriers, but were not tested for HNPCC. Two are carriers of an MMR mutation. One of them tested negative for BRCA mutations. The genetic status of the 5th and 6th woman is unknown. Interestingly, we tested the colon and breast tumors of the one patient who was a carrier of HNPCC and was tested negative for BRCA. The colon tumor was positive for MMR involvement while the breast tumor showed expression of the MMR proteins (Fig. 2B).

We have previously reported a relatively high incidence of BC in 10/24 (41%) HNPCC families [7]. Our data may genuinely reflect an increased risk for BC among HNPCC carriers in the population; however, the reported cases may also indicate the relatively high incidence of BC in the general population. The cases described in this report definitely illustrate the complexity and heterogeneity of the situation. Retained expression of MSH6 and microsatellite stability, both suggest that the one case we tested is not related to HNPCC.

Co-inheritance of both hereditary breast ovarian cancer (HBOC) and HNPCC has been reported once [19]. The presence of BRCA mutation carrier status does not negate the possibility of HNPCC mutation carrier status and vice versa; Incorporation of all clinically relevant family history as in family D should be considered while running a full diagnostic work-up.

Though co-inheritance of both syndromes does not provide a clear explanation for co-occurrence of the two malignancies in our cases; given the data presented here, especially the attenuated phenotype of the MSH6 mutation and its relatively high prevalence, it may be prudent to consider also MMR testing in suspected Ashkenazi families with HBOC and CRC. When considering the possibility of co-occurrence of two hereditary cancer syndromes one should take into account the family history and the known tumor spectrum, as well as pathological and molecular attributes of the different tumors. Clearly, a patient with a family history of breast and ovary as well as colon and endometrial cancer that presents with a basal like breast tumor and a right sided colon cancer with a prominent lymphocytic infiltrate should be tested for both BRCA and MMR germline mutations. We maintain that identification of one hereditary cancer syndrome causing mutation should not detract from looking for the presence of other cancer syndromes if the patient fulfills the screening criteria.

Appropriate screening strategies should be considered to decrease the burden of cancer; the identification of founder mutations is not only of research interest but has practical implications, in that ethnic-specific mutation analysis can be offered before a more general costly search for disease-associated mutations is attempted. This approach has been particularly successful when genetic testing for BRCA1/2 is offered to the Ashkenazi Jewish population, in which three founder mutations account for over 90% of all BRCA1/2 mutations [17]. The two mutations together, c.3984_3987dup mutation, and the c.1906G>C founder mutation, account for 14/23 (61%) of HNPCC Ashkenazi families in our cohort. Four other families harbored private mutations, and in other families the mutation has not been identified yet. These findings are of great importance for counseling, management and surveillance of Ashkenazi families with CRC or other Lynch syndrome-related tumors, even in families that do not comply with the AC, but rather fulfill the Bethesda guidelines. This will be particularly useful if immunohistochemistry documents a loss of MSH6 protein expression in the tumor.

Acknowledgments

This work was supported, in part, by the Israeli Cancer Association.

Copyright information

© Springer Science+Business Media B.V. 2009

Authors and Affiliations

  • Yael Goldberg
    • 1
  • Rinnat M. Porat
    • 2
  • Inbal Kedar
    • 4
  • Chen Shochat
    • 5
  • Daliah Galinsky
    • 1
  • Tamar Hamburger
    • 1
  • Ayala Hubert
    • 1
  • Hana Strul
    • 3
  • Revital Kariiv
    • 3
  • Liat Ben-Avi
    • 6
  • Moran Savion
    • 6
  • Eli Pikarsky
    • 2
  • Dvorah Abeliovich
    • 6
  • Dani Bercovich
    • 5
    • 7
  • Israela Lerer
    • 6
  • Tamar Peretz
    • 1
  1. 1.Sharret Institute of OncologyHadassah-Hebrew University Medical CenterJerusalemIsrael
  2. 2.Department of PathologyHadassah-Hebrew University Medical CenterJerusalemIsrael
  3. 3.Department of GastroenterologyTASMCTel AvivIsrael
  4. 4.The Raphael Recanati Genetics InstituteThe Rabin Medical CenterPetah TikvaIsrael
  5. 5.The Human Molecular Genetics & Pharmacogenetics LabMigal—Galilee Bio-Technology CenterKiryat ShmonaIsrael
  6. 6.Department of Human GeneticsHadassah-Hebrew University Medical CenterJerusalemIsrael
  7. 7.Tel Hai Academic CollegeIsraewlIsrael

Personalised recommendations