Euphytica

, Volume 179, Issue 2, pp 333–341

Comparative molecular marker-based genetic mapping of flavanone 3-hydroxylase genes in wheat, rye and barley

Authors

    • Institute of Cytology and GeneticsSiberian Branch of the Russian Academy of Sciences
    • Institute of Cytology and Genetics SB RAS
  • E. A. Salina
    • Institute of Cytology and GeneticsSiberian Branch of the Russian Academy of Sciences
  • I. E. Matthies
    • Leibniz Institute of Plant Genetics and Crop Plant Research (IPK)
  • I. N. Leonova
    • Institute of Cytology and GeneticsSiberian Branch of the Russian Academy of Sciences
  • A. Börner
    • Leibniz Institute of Plant Genetics and Crop Plant Research (IPK)
  • M. S. Röder
    • Leibniz Institute of Plant Genetics and Crop Plant Research (IPK)
Article

DOI: 10.1007/s10681-010-0337-2

Cite this article as:
Khlestkina, E.K., Salina, E.A., Matthies, I.E. et al. Euphytica (2011) 179: 333. doi:10.1007/s10681-010-0337-2
  • 196 Views

Abstract

The F3h gene encoding flavanone 3-hydroxylase, one of the key enzymes of the flavonoid biosynthesis pathway, is involved in plant defense response, however, it has not yet been genetically mapped in such important crop species as wheat, barley and rye. In the current study, the F3h genes were for the first time genetically mapped in these species, using microsatellite and RFLP markers. The three wheat F3h homoeologous copies F3h-A1, F3h-B1 and F3h-D1, and rye F3h-R1 were mapped close to the microsatellite loci Xgwm0877 and Xgwm1067 on chromosomes 2AL, 2BL, 2DL, and 2RL, respectively. Wheat F3h-G1 and barley F3h-H1 were also mapped at the homoeologous F3h-1 position on chromosomes 2GL and 2HL, respectively. The non-homoeologous F3h gene (F3h-B2) was mapped on wheat chromosome 2BL about 40 cM distal to the F3h-1 map position. The results obtained in the current study are important for further studies aimed on manipulation with F3h expression (and, hence, plant defense) in wheat, barley and rye.

Keywords

Flavonoid biosynthesisFlavanone 3-hydroxylasePlant defense responseWheatRyeBarleyGenetic mapping

Introduction

Cultivated plants are constantly attacked by a large number of pathogenes and are exposed to different kinds of abiotic stress factors. Plant defense involves a broad class of genes known as defense response (DR) genes which include the F3h gene encoding flavanone 3-hydroxylase (F3H; EC 1.14.11.9). F3H catalyses one of the key steps of the flavonoid biosynthesis pathway (conversion of flavanones to dihydroflavonols) yielding a large family of flavonoid compounds which are involved in many biological activities including coloration of flowers, seeds and other plant organs, seed dormancy and longevity, seed coat permeability, ultraviolet radiation protection, antimicrobial activity, antioxidant activity, plant defense response to a broad spectrum of abiotic and biotic stress factors and medicinal properties (Marbach and Meyer 1974; Freed et al. 1976; Halloin 1982; Ryan et al. 2001; Winkel-Shirley 2002; Gould 2004).

Direct relationship between F3h expression level and disease resistance in different plant species has been shown (Ardi et al. 1998; Cho et al. 2005; Giovanini et al. 2006). The F3h gene was the only one among 12,000 transcripts with differential expression pattern in leaves of chickpea susceptible and resistant to a necrotrophic fungal pathogen, Ascochyta rabiei. Constitutive expression of F3h was lower in lines susceptible to pathotypes I and II of A. rabiei, than in lines resistant to both pathotypes (Cho et al. 2005). In avocado fruits, activity of F3h was higher in cultivars naturally resistant to fungal decay than in susceptible cultivars. F3h activity was closely followed by the pattern of epicatechin (Ardi et al. 1998). In wheat seedlings, F3h mRNA level was higher in plants infested by hessian fly than in uninfested control (Giovanini et al. 2006). Recently, association between sequence polymorphism of F3h gene and resistance to soybean mosaic virus has been shown (Cheng et al. 2010).

Thus, the F3h gene is involved in plant defense response, however, it has not yet been genetically mapped in such important crop species as wheat, barley and rye. In wheat and rye, four and one copy of F3h, respectively, have been assigned to the long arms of homoeologous group 2 chromosomes (Khlestkina et al. 2008, 2009a). Chromosome allocation of barley F3h remains unknown. Molecular-marker based genetic mapping of the F3h loci in wheat, barley and rye is an important step on the way to isolation of the complete F3h gene sequences, which is necessary for further manipulation with F3h expression (and hence, plant defense) in these species.

In the current study, we performed genetic mapping of a total of seven F3h gene copies in polyploid wheats (Triticum aestivum genome AABBDD, T. timopheevii AAGG), barley (Hordeum vulgare HH) and rye (Secale cereale RR) relative to microsatellite or RFLP markers and compared their locations with each other and with those for rice and maize F3h.

Materials and methods

Plant materials

A total of 40 parents of 25 wheat (T. aestivum or T. timopheevi/T. militinae), five parents of four rye (S. cereale), and four parents of two barley (H. vulgare) mapping populations, available either in IPK-Gatersleben (Germany) or ICG Novosibirsk (Russia) were screened for polymorphism at the F3h loci. Populations selected for mapping, their sizes, availability of microsatellite or RFLP genotyping data for target chromosomes and corresponding references are given in Table 1. ‘Chinese Spring’ (CS), ‘CS’ nulli-tetrasomic lines (Sears 1953) and ‘CS’-‘Imperial’ wheat-rye chromosome addition lines (Driscoll and Sears 1971) were used in PCR as controls.
Table 1

Populations selected for linkage mapping, segregation ratios at F3h loci, and number of microsatellite (SSR) or RFLP markers used for maps construction

Gene name

Cross

Cross number

Reference, resource used

Population type

Population size

Segregation ratio

χ2

P>

Number of markers on a map

F3h-A1

T.timopheevii k-38555/T. militinae

1

Salina et al. 2006, DNA, SSR data

F2

70

16:41:13 (1:2:1)

2.3143

0.30

15 SSRs

F3h-B1

T. aestivum ‘Saratovskaya 29’/T.spelta

2

Dobrovolskaya O. (unpublished data), DNA

F2

42

35:7 (3:1)

1.5556

0.20

13 SSRs

F3h-B2

T. aestivum ‘CS/Hope7A’/T. aestivum TRI 15010

3

Khlestkina et al. 2002, DNA

F2

74

60:14 (3:1)

1.4595

0.20

9 SSRs

F3h-D1

T. aestivum ‘Mironovskaya 808’/T. aestivum ‘Aibian’

4

Khlestkina et al. 2002, DNA

F2

71

60:11 (3:1)

3.4225

0.05

10 SSRs

F3h-G1

T. aestivum ‘Skala’/line 842*

5

Leonova et al. 2002, DNA, SSR data

F2

93

66:27 (3:1)

0.8065

0.30

6 SSRs

F3h-R1

S. cereale ‘Vyatka’/S. cereale ‘Monstrous’

6

Khlestkina et al. 2004, DNA, SSR/RFLP data

F2

72

54:18 (3:1)

0

4 SSRs, 3 RFLPs

F3h-H1

H. vulgare ‘Steptoe’/H. vulgare ‘Morex’

7

Kleinhofs et al. 1993, RFLP-data

DH-lines

77

43:34 (1:1)

1.0519

0.30

23 RFLPs

* T. aestivumT. timopheevii introgression line

Primer design and allele-specific PCR amplifications

The nucleotide sequences of the wheat and rye F3h gene copies deposited in the GenBank (DQ233636, EF463100, EU402957, EU402958, EU815625; http://www.ncbi.nlm.nih.gov) were aligned employing Multalin v5.4.1 (Corpet 1988). First four copy-specific primer pairs (Table 2) were constructed using OLIGO 7 software (Rychlik 2007). To obtain single gene copy amplification products, the 3′ end of at least one primer of each pair corresponded to the copy-specific single-nucleotide substitution. To verify the annealing of copy-specific primers to the correct wheat and rye chromosomes PCR in ‘CS’ nulli-tetrasomic and ‘CS’-‘Imperial’ addition lines was performed. The copy specific PCR fragments in ‘CS’ and ‘Imperial’ were 100% identical to the nucleotide sequences of the corresponding F3h genes deposited in the GenBank. Another four verified copy-specific primer pairs (Table 2) were available from Khlestkina et al. (2008). Touchdown PCR was performed in 20 μl of reaction mixture containing 50 ng of template DNA, 67 mM Tris-HCl, pH 8.8, 1.8 mM MgCl2, 0.01% Tween 20, 18 mM (NH4)2SO4, 0.2 mM of each dNTP, 0.25 μM of each primer and one unite of Taq DNA polymerase (Medigen Ltd., Russia) on an Eppendorf Mastercycler with the following profile: 1 cycle at 94°C for 2 min; 13 cycles at 94°C for 15 s, 65°C for 30 s (decrease of 0.7°C/cycle), 72°C for 45 s; 24 cycles at 94°C for 15 s, 56°C for 30 s, 72°C for 45 s; and 1 cycle at 72°C for 5 min. PCR products were separated in 2% agarose gel.
Table 2

F3h gene copy-specific and pyrosequencing primers designed for wheat, rye and barley used for screening parents of the mapping populations

Designation of the primer (primer pair no)

PCR fragment length (bp)

Portion of lines showed reproducible non-amplification (%)

Forward primer

Reverse primer

Gene region containing primer annealing sight

Forward

Reverse

F3H-B1 (1)

830

33

TGACGCGCCTCTCTCGCGAG

ACCGCCCGTAGTCCCGTGCT

Exon 1

Exon 2

F3H-B2

174

13

GCTGCCTGCCGAGGACAAGG

GCGTCGCCACACGAACCAAT

Exon 1

Intron 1

F3H-D1 (2)

319

41

ACGCGCCTCTCTCGCGAA

CCACCTCCCGTAGTCCCG

Exon 1

Exon 2

F3H-R1

478

40

CCGCAGCCGGACCTCACA

TTGGCGAGGTCGAGGTCGCGCTT

Exon 2

Exon 3

F3H-A1

703

13

Primers are described in Khlestkina et al. (2008)

Exon 1–Intron 1

Exon 2

F3H-B1 (2)

333

4

Exon 2

Intron 2

F3H-D1 (1)

225

0

Exon 1–Intron 1

Exon 2

F3H-G1

371

0 (T. timopheevii) and 100 (T. aestivum)

Exon 2

Intron 2

F3H-H1 (2)

115

 

CGTCGACATGGACCAGAAAG

B-GCAGGAGGAGCGTTATGGT

Exon 2

Exon 2

F3H-H1 (2S)

 

GCAGCCCGACCTCAC

Exon 2

 

F3H-H1 (6)

133

CAGTACCCCCTTCATCTTCTTCCA

B-TTCTTGAACCTGCCGTTGCT

Intron 2

Exon 3

F3H-H1 (6S)

 

ACACCAATTGAACACG

Intron 2

 

Underlined primer pairs chosen for mapping, B labeled with Biotin, S Sequencing-primer

Pyrosequencing and SNP-marker development in barley

In barley, primer pairs for F3h were designed using a consensus sequence of the 30 single sequences derived from the UniGene cluster hv. 143 (http://www.ncbi.nlm.nih.gov). A 650 bp fragment could be PCR-amplified which showed highest similarity (99% identity) using BLAST-search (Altschul et al. 1990, 1997) to F3h mRNA (X58138, gi: 18975; Meldgaard 1992). For SNP-detection suitable primer combinations were designed with biotinylated reverse primer and forward sequencing primer (Table 2) by using PSQ Assay Design Software version 1.0.6 (2004) provided by Biotage, Sweden (Table 2). The sequencing primers F3H-H1 (2S) and F3H-H1 (6S) (Table 2) of the Pyrosequencing-assays are optimized by the design software (Biotage, Uppsala, Sweden) and are specific for these SNPs in those generated PCR fragments. The PCR-conditions were as described in Malysheva-Otto and Röder (2006). Pyrosequencing was carried out according to manufacturer’s protocol on a PSQTMHS9A (Biotage, Sweden). Data were evaluated by using the manufacturer’s software.

Linkage maps construction

Monogenic segregation ratios in genotyped mapping population at the F3h loci were examined by the χ2 test (Table 1). The F3h loci were mapped relative to RFLP or microsatellite markers. Linkage maps were constructed with MAPMAKER 2.0 (Lander et al. 1987). For microsatellite analysis, Gatersleben wheat microsatellite (GWM) markers mapping to chromosomes 2B and 2D were chosen. The characteristics of the microsatellites, and the experimental procedures associated with their use are described by Röder et al. (1998). Unpublished primer sequences are available upon request.

Results

Genotyping of mapping populations at the F3h loci

The 40 parents of the 25 wheat and the five parents of the four rye mapping populations were analyzed using the gene copy-specific primer pairs (Table 2). Reproducible non-amplification in certain parental lines was detected (Table 1). An example is given in Fig. 1a (lane 5). The intervarietal presence/absence polymorphism we observed (Fig. 1a) can be explained by co-localization of copy-specific nucleotide substitutions and intervarietal SNPs at the primer annealing sites as has been proposed by Kozlova et al. (2009). Besides the presence/absence polymorphism, amplification of fragments different in length was observed between the T. timopheevii and T. militinae F3h-A1 genes (Fig. 1b). It was likely due to that the F3h-A1 intron 1 has different length in these species. A number of polymorphic mapping populations were chosen for further genotyping (Table 1). The segregation ratio of the amplifying to the non-amplifying genotypes of the F2 populations 2–6 conformed to the expected 3:1, while that in the population 1 (T.timopheevii/T. militinae) conformed to the expected 1:2:1 (Table 1).
https://static-content.springer.com/image/art%3A10.1007%2Fs10681-010-0337-2/MediaObjects/10681_2010_337_Fig1_HTML.gif
Fig. 1

PCR amplifications in some parents of the mapping populations utilized in the current study. a PCR product obtained with the gene copy-specific primer pair “F3H-B2”; 1 1 kb marker of DNA length, 2 ‘W7984’, 3 ‘Opata 85’, 4 ‘CS/Hope 7A’, 5 ‘TRI 15010’, 6 ‘TRI 2732’, 7 ‘Mironovskaya 808’, 8 ‘Ai-bian’, 9 ‘Lgst’. b PCR product obtained with gene copy-specific primer pair “F3H-A1”; 1 100 bp marker of DNA fragment length, 2T. timopheevii, 3T. militinae, 4 heterozygous plant from F2 population. The primers structure and length of the PCR products are given in Table 2

Two SNP sites showed polymorphism between the parents of barley mapping population ‘Steptoe’/‘Morex’ (Table 1); one represented a silent mutation and was found in the exon 2, whereas another one was located in the intron 2 (Table 2). Both polymorphic SNPs were used for genotyping 94 double haploid lines of ‘Steptoe’/‘Morex’ mapping population. Co-segregation of the two SNPs in the mapping population was observed. Therefore, only one of them (Table 2) was used for further mapping. The segregation ratio in the barley mapping population conformed to the expected 1:1 (Table 1).

Comparative mapping of the F3h genes in wheat, rye and barley

Microsatellite analysis was performed in the populations 2, 3 and 4, using polymorphic GWM markers mapping to chromosomes 2B and 2D (Table 1). In the populations 1, 5, 6 and 7, microsatellite or RFLP mapping data for appropriate chromosomes have been available from the previous studies (Table 1). Genetic maps were constructed on the basis of genotyping data at the F3h, microsatellite or RFLP loci (Fig. 2). The gene copy F3h-A1 was mapped on the long arm of chromosome 2A proximal to Xgwm1070 (11.4 cM) and distal to Xgwm1067 (2.1 cM). F3h-B1 was closely linked to Xgwm1067 and Xgwm0877 (0.0 cM), and was proximal to Xgwm1070 (6.7 cM) on the long arm of chromosome 2B, while F3h-B2 mapping to the same chromosome arm was 30.1 cM distal to Xgwm1070 and closely linked to Xgwm1027 located to the distal end of the long arm of chromosome 2B. F3h-D1 was mapped on the long arm of chromosome 2D co-segregating with Xgwm1264, distal to Xgwm0877 (1.8 cM) and proximal to Xgwm0301 (22.7 cM). Thus, in wheat the three F3h-1 gene copies were mapped closely linked to the homoeologous microsatellite loci Xgwm1067 or Xgwm0877, whereas F3h-B2 was found about 40 cM distal to the homoeoloci mapping position and closely linked to Xgwm1027 (Fig. 2). F3h-G1 was mapped on the long arm of chromosome 2G, proximal to Xgwm1027 (39.3 cM), which led to the conclusion that it belongs to the homoeologous set F3h-1 (Fig. 2).
https://static-content.springer.com/image/art%3A10.1007%2Fs10681-010-0337-2/MediaObjects/10681_2010_337_Fig2_HTML.gif
Fig. 2

Genetic mapping of the F3h loci in wheat, rye and barley. Chromosome arm designations are shown at the top and bottom of each chromosome. The F3h and DNA-marker loci names are given to the right, while genetic distances (in centiMorgans) are shown to the left of each chromosome. Information on each of the F2 mapping populations can be found in Table 1

The rye F3h-R1 gene was also found at the homoeologous map position, 11.7 cM distal to the anchor marker Xgwm0877 on the long arm of chromosome 2R. The F3h gene in barley was mapped on the long arm of chromosome 2H closely linked to Xabc252 (0.0 cM), distal to Xabg072 (21.4 cM), and proximal to Xabc157 (8.8 cM) and Xcmwg720 (32.8 cM) (Fig. 2). Considering the close linkage (0.8 cM) of RFLP loci Xcmwg720 and Xcmwg660 (Börner et al. 1999), and based on the fact of that Xcmwg660 was mapped 32 cM distal to Xgwm0877 in rye (Khlestkina et al. 2004), we can infer that barley F3h is located at the homoeologous F3h-1 position (Fig. 2). This gene was designated F3h-H1.

Discussion

DNA markers, in particular RFLPs and microsatellites, have facilitated the precise mapping of several sets of wheat genes, and this has provided good support for the existence of homoeologous series. Homoeologous sets of genes have been defined for red grain color (R) (Flintham and Gale 1995), glume color (Rg) (Khlestkina et al. 2006, 2009b), awn color (Bla) (Börner et al. 2002), sphaerococcoid spike morphology (S) (Salina et al. 2000), anthocyanin pigmentation of different plant organs (Rc, Pc, Pan, Plb) (Khlestkina et al. 2002, 2009c, 2010a) and for ent-kaurenoic acid oxidase (KAO) which catalyses three steps in the gibberellin biosynthesis pathway (Khlestkina et al. 2010b). Comparative genetic mapping in wheat, rye and barley has been performed for the homoeoloci affecting plant height and development (Börner et al. 1998) and the homoeoloci controlling waxless plant, waxy endosperm and absence of ligules (Korzun et al. 1997).

In the current study, the homoeologous genes (F3h-1) encoding flavanone 3-hydroxylase involved in plant defense were mapped close to the microsatellite loci Xgwm0877 and Xgwm1067 on the long arm of chromosome 2 in wheat and rye (Fig. 2). Barley F3h was mapped at the homoeologous position on chromosome 2HL (Fig. 2), and therefore was assigned to the F3h-1 homoeologous gene series. This is in agreement with the assumed microsynteny of Triticeae genomes and may suggest that the mutant locus ant17 mapped to chromosome 3HS (Franckowiak 1997) is not a structural gene for barley flavanone 3-hydroxylase as was proposed earlier (Meldgaard 1992). In rice, the gene encoding flavanone 3-hydroxylase was found in the BAC clone Os04g0662600 (GenBank accession NM_001060692) assigned to chromosome 4 (Ohyanagi et al. 2006) having synteny with chromosome 2 of barley (Stein et al. 2007) and wheat (Conley et al. 2004). In maize, in spite of widespread of gene duplications in the genome, a single copy of F3h is present which has been mapped on chromosome 2 (Deboo et al. 1995) having synteny with rice chromosome 4 (Ahn and Tanksley 1993).

A non-homoeologous F3h gene (F3h-B2) is present in the B genome of wheat, which was mapped on chromosome 2BL as far as 40 cM distal to the F3h-1 map position (Fig. 2). Both F3h on wheat chromosome 2B have been assigned to the same terminal bin 2BL6 (Khlestkina et al. 2008). For comparison, the previous deletion map and the current genetic maps of chromosome 2B are presented at Fig. 3. The large genetic distance (about 60 cM) corresponds to the small physical region 2BL6 (Figs. 3a, b), which is typical for the regions of chromosomes close to the telomeres, whereas in the regions close to the centromeres the opposite ratio (small genetic distance over large physical region) has been observed (Sourdille et al. 2004). F3h-B2 is quite distinct from the F3h-1 copies with respect to sequence and gene expression (Khlestkina et al. 2008, 2009a). Nevertheless, Ka (non-synonymous nucleotide substitutions)/Ks (synonymous nucleotide substitutions) ratios between F3h-B2 and different F3h-1 genes are close 0.2 (Khlestkina, data unpublished) and do not tend to approach 1, suggesting that F3h-B2 is not undergoing pseudogenization. The reason for this copy maintenance can be its tissue-specific subfunctionalization: unlike F3h-1 it is not expressed in anthocyanin-colored coleoptiles but is transcribed in wheat roots (Khlestkina et al. 2008). Wheat F3h homoeologous copies F3h-A1, F3h-B1 and F3h-D1 are expressed equally in colored coleoptiles of different wheat genotypes (Khlestkina et al. 2008, 2010a). Expression of wheat F3h-G1 gene has not yet been studied. However, high nucleotide and amino acid sequence identity of F3h-G1 with other F3h-1 genes (Khlestkina et al. 2008) suggests F3h-G1 to be a functional copy. Rye F3h-R1 is expressed in colored coleoptiles of rye and wheat-rye 2R(2D) chromosome substitution line carrying F3h-R1 along with wheat homoeologues (Khlestkina et al. 2009a). Expression of barley F3h in colored testa pericarp tissue has been shown by Meldgaard (1992).
https://static-content.springer.com/image/art%3A10.1007%2Fs10681-010-0337-2/MediaObjects/10681_2010_337_Fig3_HTML.gif
Fig. 3

Comparison between wheat chromosome 2B deletion (a, Khlestkina et al. 2008) and genetic (b and c) maps. Microsatellite marker loci (Xgwm) designations are given to the right from each chromosome scheme, whereas chromosome bin names (a) or genetic distances (in centiMorgans; b and c) are indicated to the left

Thus, a total of seven functional copies of the F3h gene were genetically mapped in wheat, barley and rye (Fig. 2). The results obtained are important for further studies aimed on manipulation with F3h expression (and, hence, plant defense) in these crop species.

Acknowledgments

The study was supported by the Russian Foundation for Basic Research (08-04-00368-a), SB RAS (Lavrentjev project 6.5), L’Oreal-UNESCO fellowship and the Federal Targeted Program of the Russian Federation (state contract P409). The part considering the mapping in barley was conducted in the frame of a GABI-project (0313125A) funded by the BMBF (Bundesministerium für Bildung und Forschung) in Germany.

Copyright information

© Springer Science+Business Media B.V. 2010