Conservation Genetics

, Volume 8, Issue 6, pp 1495–1497

Development and characterization of microsatellite markers for an endangered shrub, Ammopiptanthus mongolicus (Leguminosae) and cross-species amplification in Ammopiptanthus nanus

Authors

  • Guo-Qing Chen
    • South China Botanical GardenThe Chinese Academy of Sciences
    • Graduate School of the Chinese Academy of Sciences
  • Hong-Wen Huang
    • South China Botanical GardenThe Chinese Academy of Sciences
    • Wuhan Botanical GardenThe Chinese Academy of Sciences
  • Ming Kang
    • Wuhan Botanical GardenThe Chinese Academy of Sciences
    • State Key Laboratory of Biocontrol, School of Life SciencesSun Yat-Sen University
Technical Note

DOI: 10.1007/s10592-007-9306-2

Cite this article as:
Chen, G., Huang, H., Kang, M. et al. Conserv Genet (2007) 8: 1495. doi:10.1007/s10592-007-9306-2

Abstract

We developed 11 polymorphic microsatellite markers for an endangered shrub Ammopiptanthus mongolicus using the Fast Isolation by AFLP of Sequences Containing repeats protocol. Polymorphism of each locus was assessed in 24 individuals from five natural populations of A. mongolicus. The average allele number of these markers was 4.2, ranging from 2 to 7. The observed (HO) and expected (HE) heterozygosities were 0.044–0.956 and 0.044–0.827, respectively. Further assessment in the congeneric species A. nanus revealed that nine of eleven loci were successfully amplified, but only two loci showed polymorphism. These markers provide powerful tools for the conservation genetics studies of A. mongolicus.

Keywords

Ammopiptanthus mongolicusEndangered speciesFIASCOGenetic diversityMicrosatellite markers

The genus Ammopiptanthus (Leguminosae) is endemic to the eastern desert of central Asia, including two species: A. mongolicus (Maxim.) Cheng f. and A. nanus (M. Pop.) Cheng f. (Cheng 1959). Ammopiptanthus is the only genus with evergreen broadleaf habit and both species are dominant in the local vegetation, so this genus plays an important role in fixing moving sands and delaying further desertification. However, in the past decades, the populations of Ammopiptanthus have been severely disturbed by anthropogenic activities (e.g., cutting for firewood and coal mining). Both species has been categorized as ‘endangered’ in China (Fu and Jin 1992). As very little allozyme diversity was detected in both species (Chen et al. unpublished result), it proved difficult to give precise evaluations on their genetic variation, population structure and gene flow using only allozyme markers. The microsatellite loci are expected to reveal higher allelic diversity and so to provide detailed population genetic information, which if available could be useful for the conservation and management of endangered species. Here, we report isolation and characterization of a set of polymorphic microsatellite loci from the genome of A. mongolicus in order to provide baseline information of population genetic diversity for the genus.

Total DNA was isolated from silica-dried leaf tissue of A. mongolicus using the DNeasy Plant Mini Kit (QIAGEN). An enriched partial genomic library was then constructed using the FIASCO (fast isolation by AFLP of sequences containing repeats) protocol (Zane et al. 2002) with minor modifications. About 250 ng genomic DNA was digested with 3 U of MseI (New England Biolabs) in a 25 μl volume and then 15 μl digested DNA was ligated to MseI AFLP adaptor pair (5′-TAC TCA GGA CTC AT-3′/5′-GAC GAT GAG TCC TGA G-3′) using 1 U of T4 DNA ligase (Fermentas) in a volume of 30 μl. Diluted digestion-ligation mixture (1:10) was amplified with AFLP adaptor-specific primers (5′-GAT GAG TCC TGA GTA AN-3′) using a program of 94°C 30s, 53°C 1 min, 72°C 1 min for 20 cycles. Amplified DNA fragments, with a size range of 200 to 1000 bp, was hybridized with 0.15 μM of 5′-biotinylated (AC)15 oligo-nucleotide in 250 μl hybridization mixture containing SSC 4.2X and SDS 0.07%. The mixture was annealed at 48°C for 2 h following denaturation at 95°C for 5 min. DNA fragments hybridized to biotinylated probes were selectively captured by Streptavidin MagneSphere® Paramagnetic Particles (Promega) according to the procedure of Zane et al. (2002), with the exception that unrelated PCR products were not mixed with the particles before adding the hybridization mixture. Recovered DNA fragments were amplified with MseI-N primers as described above. After purification using E.Z.N.A.® Gel Extraction Kit (OmegaBiotek), PCR products were ligated into pMD18-T plasmid vector (TaKaRa) and transformed into JM 109 competent cells (Promega). Recombinant clones were PCR amplified using M13 universal primers and sequenced with ABI BigDyeTM Terminators Cycle Sequencing Kit (Applied Biosystems) in an ABI PRISM3100 automated sequencer.

Of the 68 clones sequenced, 41 (60.3%) were found to contain simple sequence repeats. However, 25 of the 41 sequences were discarded because either the repeat was too short or the flanking regions of the repetitive sequence were not suitable for designing primers. Sixteen primer pairs flanking microsatellite regions were designed using PRIMER 3.0 (Rozen and Skaletsky 2000). All these microsatellite primers were tested using 24 individuals of A. mongolicus from 5 natural populations. PCR amplification was performed in a 10 ul reaction volume containing 50 ng genomic DNA, 0.2 μM of each primer, 200 μM of each dNTP, 1 × Taq buffer (100 mM Tris-HCl, pH 8.8, 2.0 mM MgCl2, 200 mM (NH4)2SO4, 0.1% Tween 20) and 0.5 U of Taq polymerase (Takara). The PCR profile was initial denaturation for 5 min at 94°C, followed by 32 cycles of 30s at 94°C, 45s at annealing temperatures (See Table 1), and 45s at 72°C, with a final extension of 10 min at 72°C. Amplified products were separated on a 6% denaturing polyacrylamide gel using silver staining. A 25 bp DNA ladder (Promega) was used to identify alleles.
Table 1

Characterization of 11 polymorphic microsatellite loci in the genome of Ammopiptanthus mongolicus

Locus

Repeat motif

Primer sequences

Ta (°C)

Allele size (bp)

NA

HOHE

GenBank accession no.

Am 02

(AC)12...(AC)5...(AC)12

F: TGTATGCTCTTACTGCTTTGGA

63

207–215

3

0.095a

EF094979

R: GTGCGTGTGTGTTTGTTTCC

0.223

Am 03

(AC)9(AT)6

F: TCGTGTTCCAAAGGCTATGA

58

192–180

3

0.333a

EF094980

R: CAATGGCTGCAATCAATGTC

0.554

Am 05

(AC)11

F: GGTGGAGGTACCAACTTTGC

58

168–174

3

0.375

EF094981

R: TTTGCTCAACATTGGTGGTG

0.489

Am 06

(GA)4(GT)11

F: GGCGAAACCGAAGTAAGAAT

58

219–197

5

0.667

EF094982

R: GCAAACTGAAGGGTCACTCG

0.724

Am 07

(AC)18

F: CCGGCCCATACATACATACA

58

206–234

7

0.956a

EF094983

R: GGCATTTTGCCTTGGATAGA

0.794

Am 08

(GC)4(AC)11

F: TAACACAATCGGCAGATCCA

59

194–218

6

0.409a

EF094984

R: AAAAGGCCAGCTCACTTGAT

0.761

Am 09

(AT)16(GT)21

F: GGAATAGGTTCGCCATCACT

59

185–217

7

0.304a

EF094985

R: AGCCAGTCCTATGCTCATCC

0.827

Am 10

(CT)8AAAAT(CA)7

F: AATTTGTGCCTTTGCCTTTG

60

153–155

2

0.044

EF094986

R: TCCATGTCGTACTCGTGTGG

0.044

Am 12

(CTT)10ATT(CTT)4

F: CACTCTCCCAAAACCCACAC

60

161–167

2

0.500

EF094987

R: GAGGAATCAACTTTCTTTCACAA

0.380

Am 13

(GT)9... (GT)20

F: CAAATCAGGCATGCAAATAA

63

198–214

5

0.348a

EF094988

R: TGTATGCTCTTACTGCTTTGGA

0.774

Am 16

(CA)5...(CA)5...(CA)4(CG)3(CA)3...(CA)6

F: TGTTGGGGTCAAACCTTTTC

58

244–252

3

0.458

EF094989

R: GTCGCCTTTTGAGGATGAAG

0.610

aindicates the observed heterozygosity is significantly different from the expected heterozygosity under Hardy-Weinberg equilibrium (P < 0.01)

Ta, PCR annealing temperature; NA, number of alleles; HO, observed heterozygosity; HE, expected heterozygosity

Thirteen of the 16 primer pairs tested successfully amplified the target fragments in A. mongolius, and 11 loci showed polymorphism. The number of alleles per locus, observed (HO) and expected heterozygosity (HE), conformance to Hardy–Weinberg equilibrium (HWE) expectations, and population genotypic disequilibrium were assessed using GENEPOP software (http://wbiomed.curtin.edu.au/genepop/) (Raymond and Rousset 1995). The 11 polymorphic loci revealed a total of 46 alleles across the A. mongolius individuals tested, ranging from 2 to 7 alleles per locus (Table 1). HO and HE varied from 0.044 to 0.956 and 0.044 to 0.827, respectively. Five of the 11 polymorphic loci showed significant deviation from Hardy–Weinberg equilibrium (HWE) (< 0.01), and of which four loci showed deficits of heterozygotes (Table 1). The departures from HWE could be due to the small sample size or the presence of null alleles. Two pairs of loci (Am08 and Am16, Am09 and Am16) showed significant linkage disequilibrium (LD) (< 0.01) among 55 pariwise tests. However, no significant LD was found after correction for multiple tests (< 0.00091).

Cross-species amplification in A. nanus was further investigated using 24 individuals from 5 natural populations. Nine of the 11 loci were successfully amplified, but only two loci (AM13 and AM16) showed polymorphism with two alleles each. Moreover, both polymorphic loci showed heterozygotes deficits (AM13: HO = 0.083 vs. H= 0.389; AM16: HO = 0.292 vs. HE = 0.493). Therefore, these markers have limited application in A. nanus. But in any case, the 11 polymorphic microsatellite loci presented here could be applied to the study of population genetics of A. mongolius and will provide useful implications for conservation and management.

Acknowledgements

We are grateful to YF Liu, YQ Xu for their technical assistance. This work was financially supported by the National Natural Foundation of China (Grant No. 30370282) and the Key Project of the Chinese Academy of Sciences (CAS) (KSCX2-SW-104).

Copyright information

© Springer Science+Business Media, Inc. 2007