Breast Cancer Research and Treatment

, Volume 109, Issue 1, pp 177–179

Is BRCA2 c.9079 G > A a predisposing variant for early onset breast cancer?

Authors

  • Fleur Hammet
    • Genetic Epidemiology Laboratory, Department of PathologyUniversity of Melbourne
  • Jessica George
    • Genetic Epidemiology Laboratory, Department of PathologyUniversity of Melbourne
  • Andrea A. Tesoriero
    • Genetic Epidemiology Laboratory, Department of PathologyUniversity of Melbourne
  • Mark A. Jenkins
    • Centre for Molecular, Environmental, Genetic and Analytic EpidemiologyUniversity of Melbourne
  • Christopher Schroen
    • Genetic Epidemiology Laboratory, Department of PathologyUniversity of Melbourne
  • Letitia Smith
    • Genetic Epidemiology Laboratory, Department of PathologyUniversity of Melbourne
  • Anke Grabosch-Meehan
    • Genetic Epidemiology Laboratory, Department of PathologyUniversity of Melbourne
  • Gillian Dite
    • Centre for Molecular, Environmental, Genetic and Analytic EpidemiologyUniversity of Melbourne
  • Margaret R. E. McCredie
    • The University of Otago
  • Graham G. Giles
    • Cancer Epidemiology Centre, Cancer Council Victoria
  • Sean V. Tavtigian
    • International Agency for Research on Cancer
  • John L. Hopper
    • Centre for Molecular, Environmental, Genetic and Analytic EpidemiologyUniversity of Melbourne
    • Genetic Epidemiology Laboratory, Department of PathologyUniversity of Melbourne
    • International Agency for Research on Cancer
Letter to the Editor

DOI: 10.1007/s10549-007-9624-6

Cite this article as:
Hammet, F., George, J., Tesoriero, A.A. et al. Breast Cancer Res Treat (2008) 109: 177. doi:10.1007/s10549-007-9624-6
  • 78 Views

To the Editor,

Only a small proportion of early onset breast cancer is associated with mutations in known breast cancer susceptibility genes [13]. For example, our work in a population-based case-control-family study of Australian women diagnosed with first primary invasive breast cancer before the age of forty years (Australian Breast Cancer Family Study, ABCFS) [1, 4] has found, after extensive mutation screening, that less than 10% of cases carry germline mutations in BRCA1 and BRCA2 that are known to be cancer predisposing [1, 2, 4, 5]. We have also detected several rare variants in BRCA1 and BRCA2 that currently have an unknown cancer predisposition potential.

In particular, we identified apparent homozygocity of BRCA2 c.9079 G > A in a woman diagnosed with a grade 3 (malignant nuclear grade, mitotic index of 20 mitoses per high powered field and <10% tubule formation) ER+/PR−, infiltrating ductal carcinoma at age 37 years. This tumour morphology was not inconsistent with the morphology of breast cancers arising in BRCA2 mutation carriers [6, 7]. No other BRCA1, BRCA2 or TP53 mutations were identified in the germline of the index case despite exonic sequencing and large deletion screening (via MLPA) of these genes. This case did not carry ATM c.4258C > T or CHEK2 c.1100delC.

Figure 1 shows that the index case had a strong family history of breast cancer with two paternal aunts and a paternal grandmother diagnosed with the disease at ages 43, 47 and 80 years respectively. Members of this family who had provided the study with a blood sample were genotyped for BRCA2 c.9079 G > A. Two unaffected siblings were also homozygotes (AA) at this position and the affected paternal aunts had genotypes GA and GG. Lack of segregation within clinically selected multiple-case cancer families has been reported previously for this variant [8].
https://static-content.springer.com/image/art%3A10.1007%2Fs10549-007-9624-6/MediaObjects/10549_2007_9624_Fig1_HTML.gif
Fig. 1

Pedigree of index case. Filled circles, affected with breast cancer; Bold outlined circle, index case; Age at interview or age at breast cancer diagnosis and genotype of BRCA2 c.9079 G > A indicated

To assess the potential association of this variant with breast cancer risk we genotyped population-based early-onset breast cancer cases (diagnosis before the age of 40 years) and controls, frequency matched for age, from the ABCFS for the BRCA2 c.9079 G > A variant using DNA extracted from Guthrie card spots and a Taqman MGB probe. [forward primer 5′ ACAAGCTCAGATCCAGTTGGAAATT, reverse primer 5′ GACATCCCTTGATAAACCTTGTTCCT, FAM probe 5′ ATTCCATGGCCTTCCT and VIC probe 5′ ATTCCATGGTCTTCCT].

Table 1 shows that BRCA2 c.9079 G > A was carried in 9/768 (1.17%) breast cancer cases diagnosed under the age of 40 years and 2/791 (0.25%) population-based controls. Only the initial index case was found to be homozygous for this variant. The allele frequencies were 0.65 and 0.13%, respectively (Yates’ adjusted P = .04). When analysed as a case-control study the odds ratio for carrying the minor allele (A) and risk of developing early-onset breast cancer was 4.7 (Exact 95% CI 1.0–45; Yates’ adjusted P = .06).
Table 1

BRCA2 c.9079 G > A genotyping results

 

Genotype

Number

Allele frequency (A)

OR (95% CI)

Controls

GG

789

  

GA

2

  

AA

0

0.0013

 

Fail

0

  

Total

791

  

Cases

GG

759

  

GA

8

  

AA

1

0.0065

4.7 (1–45)

Fail

2

  

Total

770

  

This nucleotide substitution corresponds to the missense substitution A2951T. In a protein multiple sequence alignment of five mammalian BRCA2s plus orthologs from chicken, frog, pufferfish, and sea urchin (available online at <http://agvgd.iarc.fr/alignments>), amino acids observed at this position of the protein are alanine and serine. The missense residue threonine is only slightly outside of this range of variation (the Grantham Variation is 29.4); consequently, the probability that this substitution would alter protein function sufficiently to constitute a high-risk variant is low. This nucleotide change is not predicted to effect splicing (SpliceSiteFinder, http://violin.genet.sickkids.on.ca/∼ali/splicesitefinder.html) but does create an additional exonic splice enhancer SRp40 motif (ESE, http://rulai.cshl.edu/tools/ESE/ESEbkgr.html) which is of unknown significance.

Several pieces of evidence suggest that his variant alone does not convey very high risk of breast cancer including lack of segregation with disease in some families and its’ co-occurrence with other known BRCA1 and BRCA2 pathogenic mutations in multiple-case clinically tested families [8]. However, given our findings, we cannot exclude the possibility that c.9079 G > A may be a rare, modest-risk variant, a modifier of risk, or a variant of relevance to polygenic models of breast cancer risk. Additional work using larger studies will be required to further test the possibility of an association between the rare BRCA2 c.9079 G > A variant and breast cancer risk. We have genotyped cases, controls and relatives of cases for other more common variants and found this to be a useful approach to assessment the potential of rare variants in cancer predisposition [9].

Acknowledgements

The Australian Breast Cancer Family Study was supported by the National Health and Medical Research Council of Australia, the New South Wales Cancer Council, the Victorian Health Promotion Foundation (Australia), and the US National Cancer Institute, National Institutes of Health, under Request for Application CA-95-003 as part of the Breast Cancer Family Registries (CFRs), and through cooperative agreements with the Fox Chase Cancer Center; Huntsman Cancer Institute, Columbia University; Northern California Cancer Center; Cancer Care Ontario; and The University of Melbourne.

Copyright information

© Springer Science+Business Media, LLC 2007