Cell and Tissue Research

, Volume 330, Issue 1, pp 63–74

Induction of claudins in passaged hTERT-transfected human nasal epithelial cells with an extended life span

Authors

  • Makoto Kurose
    • Department of OtolaryngologySapporo Medical University School of Medicine
    • Department of PathologySapporo Medical University School of Medicine
    • Department of PathologySapporo Medical University School of Medicine
  • Jun-ichi Koizumi
    • Department of OtolaryngologySapporo Medical University School of Medicine
    • Department of PathologySapporo Medical University School of Medicine
  • Ryuta Kamekura
    • Department of OtolaryngologySapporo Medical University School of Medicine
    • Department of PathologySapporo Medical University School of Medicine
  • Takafumi Ninomiya
    • Departments of AnatomySapporo Medical University School of Medicine
  • Masaki Murata
    • Department of PathologySapporo Medical University School of Medicine
  • Shingo Ichimiya
    • Department of PathologySapporo Medical University School of Medicine
  • Makoto Osanai
    • Department of PathologySapporo Medical University School of Medicine
  • Hideki Chiba
    • Department of PathologySapporo Medical University School of Medicine
  • Tetsuo Himi
    • Department of OtolaryngologySapporo Medical University School of Medicine
  • Norimasa Sawada
    • Department of PathologySapporo Medical University School of Medicine
Regular Article

DOI: 10.1007/s00441-007-0453-z

Cite this article as:
Kurose, M., Kojima, T., Koizumi, J. et al. Cell Tissue Res (2007) 330: 63. doi:10.1007/s00441-007-0453-z

Abstract

The epithelial barrier of the upper respiratory tract, such as that of the nasal mucosa, plays a crucial role in host defense. The epithelial barrier is regulated in large part by the apical-most intercellular junctions, referred to as tight junctions. However, the mechanisms regulating of tight junction barrier in human nasal epithelial cells remain unclear because the proliferation and storage of epithelial cells in primary cultures are limited. In the present study, we introduced the catalytic component of telomerase, the hTERT gene, into primary cultured human nasal epithelial cells and examined the properties of the transfectants, including their expression of tight junctions, compared with primary cultures. The ectopic expression of hTERT in the epithelial cells resulted in adequate growth potential and a longer lifespan of the cells. The properties of the passaged hTERT-transfected cells including tight junctions were similar to those of the cells in primary cultures. The barrier function in the transfectants after treatment with 10% FBS was significantly enhanced with increases of integral tight junction proteins claudin-1 and -4. When the transfectants were treated with TGF-β, which is assosciated with nasal polyposis and chronic rhinosinusitis, upregulation of only claudin-4 was observed, without a change of barrier function. In human nasal epithelial cells, the claudins may be important for barrier function and a novel target for a drug-delivery system. Our results indicate that hTERT-transfected human nasal epithelial cells with an extended lifespan can be used as an indispensable and stable model for studying the regulation of claudins in human nasal epithelium.

Keywords

hTERTTight junctionsClaudinsTGF-βNasal epithelial cellsHuman

Introduction

The epithelial barrier of the upper respiratory tract, which is the first site of exposure to inhaled antigens, plays a crucial role in host defense in terms of innate immunity. The epithelium of the upper respiratory tract, such as that of the nasal mucosa, forms a continuous barrier against a wide variety of exogenous antigens (Herard et al. 1996; Van Kempen et al. 2000). The epithelial barrier is regulated in large part by the apical-most intercellular junctions, referred to as tight junctions (Schneeberger and Lynch 1992).

Tight junctions, the most apical component of intercellular junctional complexes, separate the apical from the basolateral cell surface domains in order to establish cell polarity (by performing the function of a fence). Tight junctions also possess a barrier function, inhibiting the flow of solutes and water through the paracellular space (Schneeberger and Lynch 1992; Gumbiner 1993). They form a particular netlike meshwork of fibrils created by the integral membrane proteins occludin and claudin and by members of the Ig superfamilies JAM and CAR (Tsukita et al. 2001; Sawada et al. 2003; Schneeberger and Lynch 2004). Several peripheral membrane proteins, ZO-1, ZO-2, ZO-3, 7H6 antigen, cingulin, symplekin, Rab3B, Ras target AF-6, and ASIP (an atypical protein kinase C-interacting protein), have been reported (Tsukita et al. 2001; Sawada et al. 2003; Schneeberger and Lynch 2004). The claudin family, consisting of 24 members, is solely responsible for forming tight junction strands (Tsukita et al. 2001). Two or more different claudin species are generally expressed in single cells in various tissues. Some members of the claudin family have been shown to confer ion selectivity to the paracellular pathway (Van Itallie and Anderson 2006). Claudin-3 and -4 are also known as receptors for Clostridium perfringens enterotoxin (CPE; Katahira et al. 1997; Fujita et al. 2000).

We have previously reported that, in the epithelium of the nasal mucosa from patients with allergic rhinitis, occludin, JAM-A, ZO-1, and claudin-1, -4, -7, -8, -12, -13, and -14 have been detected together with continuous tight junction strands that formed well-developed networks (Takano et al. 2005). However, the detailed mechanisms of the regulation of tight junctions in human nasal epithelial cells are still unclear, because primary cultures of human nasal epithelial cells are difficult to convert into continuously growing cultures, although serially passaged culture of human nasal epithelial cell monolayers show high barrier function up to passage 4 (Yoo et al. 2003).

The introduction of the catalytic unit of human telomerase, hTERT (human catalytic subunit of telomerase reverse transcriptase), into a variety of human cell types typically extends their lifespan without in general altering the growth factor requirements or tumorigenicity or causing chromosomal instability (Bodnar et al. 1998; Meyerson 1998). Evidence has been provided that human somatic cells, including fibroblasts, retinal pigment epithelial cells, endothelial cells, airway epithelial cells, lymphatic endothelial cells, and T-lymphocytes can be immortalized or have their in vitro lifespans extended by the ectopic expression of hTERT alone (Bodnar et al. 1998; Vaziri and Benchimol 1998; Yang et al. 1999; Rufer et al. 2001; Nisato et al. 2004; Piao et al. 2005).

In the present study, we have introduced the hTERT gene into primary cultured human nasal epithelial cells and characterized the transfectants, including the expression of tight junctions, in comparison with primary cultures. Furthermore, the transfectants have been treated with transforming growth factor-β (TGF-β), eotaxin, interleukin-1β (IL-1β), IL-4, IL-6, IL-13, and tumor necrosis factor-α (TNF-α), all of which are involved in the pathogenesis of nasal polyposis and chronic rhinosinusitis (Pawankar 2003), and examined for the expression and function of tight junctions. The ectopic expression of hTERT in human nasal epithelial cells results in cultures with good growth potential and a longer lifespan. The hTERT-transfectants can be propagated in culture for more than five passages before senescence. The properties of the third passaged transfectants, including tight junctions, are similar to those of primary cultures. The barrier function of the tight junctions in the transfectants after treatment with 10% fetal bovine serum (FBS) is significantly enhanced with increases of the integral tight junction proteins claudin-1 and -4. When the transfectants are treated with TGF-β, the up-regulation of only claudin-4 is observed, without a change of barrier function. These results indicate that the hTERT-transfected human nasal epithelial cells with an extended lifespan function as an indispensable model for studying the regulation of claudins in human nasal epithelium.

Materials and methods

Cytokine and antibodies

TGF-β, eotaxin, IL-1β, IL-4, IL-6, IL-13, and TNF-α were purchased from Peprotech (London, UK). Mouse monoclonal anti-occludin, anti-claudin-4, and anti-E-cadherin and rabbit polyclonal anti-JAM-A, anti-occludin, anti-claudin-1, and anti-claudin-7 antibodies were obtained from Zymed Laboratories (San Francisco, Calif.). Mouse monoclonal anti-cytokeratin7 (Ck7) and anti-Ck19 antibodies were obtained from Dako (Tokyo, Japan). Mouse monoclonal anti-p16 antibody was obtained from BD Pharmingen (San Diego, Calif.). Mouse monoclonal anti-p53 antibody was purchased from Oncogene Research Products (Boston, Mass.). Rabbit polyclonal anti-p73 antibody was from Santa Cruz Biotechnology (Santa Cruz, Calif.). Secondary antibodies, viz., Alexa 488 (green)-conjugated anti-rabbit IgG and Alexa 592 (red)-conjugated anti-mouse IgG, were purchased from Molecular Probes (Eugene, Ore.). Horseradish peroxidase (HRP)-conjugated anti-mouse IgG and anti-rabbit IgG were from Dako. The enhanced chemiluminescence (ECL) Western blotting system was obtained from Amersham (Buckinghamshire, UK).

Human nasal mucosa tissues

Human nasal mucosa tissues were obtained from patients who were suffering from hypertrophic rhinitis and who underwent inferior nasal turbinectomy. Informed consent was obtained from all patients. The study was approved by the ethics committee of Sapporo Medical University.

Isolation, cell culture, and transfection

Human nasal mucosa tissues were minced into pieces of 2–3 mm3 in volume, washed four times with phosphate-buffered saline (PBS) containing antibiotics, suspended in 10 ml dispersing solution with 0.5 μg/ml DNase I (Sigma) and 0.08 mg/ml Liberase Blenzyme 3 (Roche, Basel, Switzerland) in PBS, and then incubated at 37°C for 20 min. The dissociated specimens were subsequently filtrated with 300-μm mesh followed by filtration with 40-μm mesh. After centrifugation at 1,000g for 4 min, the cells were cultured in serum-free bronchial epithelial growth medium (BEBM, Clonetics, San Diego, Calif.) supplemented with 0.5 μg/ml hydrocortisone, 5 μg/ml insulin, 10 μg/ml transferrin, 0.5 μg/ml epinephrine, 6.5 μg/ml triiodothyronine, 50 μg/ml gentamycin, 50 μg/ml amphotericin B, 0.1 ng/ml retinoic acid, 0.5 ng/ml epidermal growth factor (Clonetics), bovine pituitary extract (1% vol/vol; Pel-Freez Biologicals, Rogers, Ark.), 100 U/ml penicillin, and 100 μg/ml streptomycin, on 35-mm or 60-mm culture dishes (Corning Glass Works, Corning, N.Y., USA) coated with rat tail collagen (500 μg dried tendon per milliliter 0.1% acetic acid). The cells were then placed in a humidified 5% CO2:95% air incubator at 37°C.

The retroviral vector BABE-hygro-hTERT (kindly provided by Dr. Robert Weinberg) was used. The viral supernatant was produced from the ecotropic packaging cell line by transfection (Kawano et al. 2003; see also supplemental data 1). The packaging cells were cultured with Dulbecco’s modified Eagle’s medium containing 10% FBS and supplemented with 100 U/ml penicillin and 100 μg/ml streptomycin. At 24 h after plating on a 35-mm dish, primary cultured nasal epithelial cells were exposed to the viral supernatant containing retrovirus overnight. After being washed with serum-free BEBM medium, the hTERT-transfectants were incubated in serum-free BEBM medium with 100 U/ml penicillin and 100 μg/ml streptomycin. The passaged transfectants were then treated with TGF-β, eotaxin, IL-1β, IL-4, IL-6, IL-13, and TNF-α for 24 h.

Cell growth assay

To determine the cell growth rate, we seeded 6-well plates at 1.5×105 cells per well. The cells were counted at day 2, day 6, day 8, and day 10 after plating.

RNA isolation and reverse transcription/polymerase chain reaction analysis

Total RNA was extracted from cell cultures in TRIzol reagent (Gibco BRL, Gaithersburg, Md.). For reverse transcription/polymerase chain reaction analysis (RT-PCR), 1 μg total RNA was reverse-transcribed into cDNA by using the manufacturer’s recommended conditions (Invitrogen, Carlsbad, Calif.). Each cDNA synthesis was performed in a total volume of 20 μl for 50 min at 42°C and terminated by incubation for 15 min at 70°C. Subsequently, RT-PCR was performed by using 2 μl of the 20-μl total RT product, PCR buffer, dNTPs, and Premix Taq DNA polymerase under the manufacturer’s recommended conditions (Takara, Siga, Japan). Conditions applied for PCR were 96°C for 30 s, followed by 30 cycles of 96°C for 15 s, 55°C for 30 s, 72°C for 1 min, and 72°C for 7 min in a PerkinElmer/Cetus Thermocycler Model 2400 (PerkinElmer, Branchburg, N.J.). Of the 20-μl total PCR, 10 μl was analyzed by electrophoresis in ethidium-bromide-impregnated 1% agarose gels. Primers used to detect hTERT, glucose-3-phosphate dehydrogenase, occludin, JAM-A, claudin-1, -2, -3, -4, -5, -6, -7, -8, -9, and -12 were as indicated in Table 1.
Table 1

Primers for polymerase chain reaction

Gene

Forward primer

Reverse primer

Product size (bp)

Occludin

TCAGGGAATATCCACCTATCACTTCAG

CATCAGCAGCAGCCATGTACTCTTCAC

136

JAM-A

GGTCAAGGTCAAGCTCAT

CTGAGTAAGGCAAATGCAG

765

Claudin-1

GCTGCTGGGTTTCATCCTG

CACATAGTCTTTCCCACTAGAAG

619

Claudin-2

GCAAACAGGCTCCGAAGATACT

CTCTGTACTTGGGCATCATCTC

718

Claudin-3

TGCTGTTCCTTCTCGCCGCC

CTTAGACGAAGTCCATGCGG

247

Claudin-4

AGCCTTCCAGGTCCTCAACT

AGCAGCGAGTAGAAG

249

Claudin-5

GACTCGGTGCTGGCTCTGAG

CGTAGTTCTTCTTGTCGTAG

527

Claudin-6

TGAGGCCCAAAAGCGGGAGC

CGTAATTCTTGGTAGGGTAC

249

Claudin-7

AGGCATAATTTTCATCGTGG

GAGTTGGACTTAGGGTAAGAGCG

525

Claudin-8

TCATCCCTGTGAGCTGGGTT

TGGAGTAGACGCTCGGTGAC

215

Claudin-9

AGGCCCGTATCGTGCTCACC

ACGTAGTCCCTCTTGTCCAG

245

Claudin-12

CTCCCCATCTATCTGGGTCA

GGTGGATGGGAGTACAATGG

201

Glucose-3-phosphate dehydrogenase

ACCACAGTCCATGCCATCAC

TCCACCACCCTGTTGCTGTA

452

hTERT

CTCTCCCCCTTGAACCTCCTCTTTC

AGGACACCTGGCGGAAGGAG

350

Western blot analysis

Cultures in 60-mm dishes were washed with PBS twice, and 300 μl buffer (1 mM NaHCO3, 2 mM phenylmethylsulfonyl fluoride) was added. The cells were scraped and collected in microcentrifuge tubes and then sonicated for 10 s. The protein concentration of the samples was determined by using the BCA Protein Assay Reagent Kit (Pierce Chemical, Rockford, Ill.). Aliquots containing 15 μg protein/lane for each sample were separated by electrophoresis in 12.5% or 4%/20% SDS polyacrylamide gels (Daiichi Pure Chemicals, Tokyo, Japan). After electrophoretic transfer to a nitrocellulose membrane (Immobilon, Millipore), the membrane was saturated for 30 min at room temperature with blocking buffer (25 mM TRIS pH 8.0, 125 mM NaCl, 0.1% Tween 20, and 4% skim milk) and incubated with monoclonal anti-Ck7, monoclonal anti-Ck19, monoclonal anti-p16, monoclonal anti-p53, polyclonal anti-p73, polyclonal anti-occludin, polyclonal anti-claudin-1, monoclonal anti-claudin-4, polyclonal anti-claudin-7, polyclonal anti-JAM-A, monoclonal anti-E-cadherin, or polyclonal anti-actin antibodies at room temperature for 1 h. The membrane was incubated with HRP-conjugated anti-rabbit or mouse IgG at room temperature for 1 h. The immunoreactive bands were detected by using an ECL Western blotting system.

Immunohistocytochemistry

For immunohistocytochemistry of human nasal mucosa, 10-μm-thick frozen sections cut on a cryostat and cells grown on coated-glass coverslips were fixed in a cold ethanol and acetone mixture (1:1) at −20°C for 10 min. After being rinsed in PBS, they were incubated with monoclonal anti-Ck7, polyclonal anti-p73, polyclonal anti-claudin-1, monoclonal anti-claudin-4, polyclonal anti-occludin, or polyclonal anti-JAM-A antibodies at room temperature for 1 h and then with Alexa 488 (green) or Alexa 592 (red)-conjugated anti-mouse IgG or anti-rabbit IgG (Molecular Probes) at room temperature for 1 h. The specimens were examined by using an epifluorescence microscope (Olympus, Tokyo, Japan) and a laser-scanning confocal microscope (MRC 1024, Bio-Rad, Hercules, Calif.).

Scanning electron microscopy

Cells grown on coated coverslips were fixed with 2.5% glutaraldehyde/0.1 M PBS (pH 7.3) overnight at 4°C. After several rinses with PBS, the cells were postfixed in 1% osmium tetroxide at 4°C for 3 h and then rinsed with distilled water, dehydrated in a graded ethanol series, and freeze-dried. The specimens were sputter-coated with platinum and observed with a scanning electron microscope (S-4300, Hitachi, Tokyo, Japan) operating at 10 kV.

Transmission electron microscopy

The cells were fixed in 2.5% glutaraldehyde/0.1 M PBS (pH 7.3) overnight at 4°C, postfixed in 2% osmium tetroxide in the same buffer, dehydrated in a graded ethanol series, and embedded in Epon 812. Ultrathin sections were then cut on a Sorvall Ultramicrotome MT-5000. The sections were stained with uranyl acetate followed by lead citrate and examined at 60 kV with a JEM transmission electron microscope (JEOL, Tokyo, Japan).

Measurement of transepithelial electrical resistance

The cells were cultured to confluence on 12-mm Transwells with 0.4-μm pore-size filters (Corning) coated with rat tail collagen. Transepithelial electrical resistance (TER) was measured by using an EVOM voltameter with an ENDOHM-12 (World Precision Instruments) on a heating plate (Fine, Tokyo, Japan) adjusted to 37°C. The resistance of blank filters was subtracted from that of filters covered with cells. The values are expressed in standard units of ohms per square centimeter and presented as the means±SD.

Data analysis

Signals were quantified by using Scion Image Beta 4.02 Win (Scion, Frederick, Mich.). Each set of results shown is representative of three separate experiments. Results are given as means±SEM. Differences between groups were tested by the two-tailed Student’s t-test for unpaired data.

Results

Characterization of first passaged primary cultured nasal epithelium and third passaged hTERT-transfectants

To establish a stable reproducible culture method for human nasal epithelial cells, we introduced the hTERT gene into primary cultured nasal epithelial cells. Without hTERT transfection, the primary cultured cells could be passaged two or three times, whereas hTERT-transfected cells could be stably passaged five or six times, thereby providing us with enough cells to perform various experiments (Fig. 1a–d; see also supplemental data 2). During these experiments, we used third passaged cells with hTERT transfection.
https://static-content.springer.com/image/art%3A10.1007%2Fs00441-007-0453-z/MediaObjects/441_2007_453_Fig1_HTML.gif
Fig. 1

Morphology of primary cultured nasal epithelial cells (a, b) and passaged hTERT-transfectants (c, d). The fifth passaged hTERT-transfectants (hTERT P5) are viable and have a cobblestone appearance, similar to primary cultures. Bars  20 μm (a, c), 10 μm (b, d)

We characterized third passaged hTERT-transfectants (hTERT P3) in comparison with first passaged cultured human nasal epithelial cells (Primary P1). In hTERT P3 cells, mRNA for hTERT and the hTERT protein were detected by RT-PCR and Western blotting (Fig. 2a,b). Expression of the airway epithelial markers Ck7 and Ck19 and of the cell-cycle associated proteins p16, p53, and p73 was detected in hTERT P3 cells and was similar to that in Primary P1 cells (Fig. 2c). On immunostaining, the expression of Ck7 and p73 (found in human nasal epithelium in vivo) was observed in most Primary P1 cells and hTERT P3 cells (Fig. 2d–f). Furthermore, cilia-like structures, a differentiation marker of nasal epithelial cells, were observed together with many microvilli on the surface of hTERT P3 cells (Fig. 3a). The cilia-like structures exhibited some microtubules (Fig. 3b). We determined the cell growth rate of Primary P1 cells and hTERT P3 cells. The cell growth rate of hTERT P3 cells was stably maintained until day 10 after plating, as was that of the Primary P1 cells (Fig. 3c).
https://static-content.springer.com/image/art%3A10.1007%2Fs00441-007-0453-z/MediaObjects/441_2007_453_Fig2_HTML.gif
Fig. 2

Characterization of third passaged hTERT-transfectants (hTERT P3) compared with first passaged primary cultures (Primary P1). a, b Detection of mRNA for hTERT and the hTERT protein by reverse transcription/polymerase chain reaction (RT-PCR) and Western blotting in Primary P1 and hTERT P3 cells (M 100-bp ladder DNA marker). c Western blotting reveals the similar expression of Ck7, Ck19, p16, p53, and p73 in hTERT P3 cells and Primary P1 cells. d–f After immunostaining, the expression of Ck7 and p73, which are both expressed in human nasal epithelium (d) in vivo, are also observed in most Primary P1 cells (e) and hTERT P3 cells (f). Bars 50 μm (d), 20 μm (e, f)

https://static-content.springer.com/image/art%3A10.1007%2Fs00441-007-0453-z/MediaObjects/441_2007_453_Fig3_HTML.gif
Fig. 3

Scanning electron-microscopic (a) and transmission electron-microscopic (b) analyses of third passaged hTERT-transfectants. a Cilia-like structures are present on the surface. b The cilia-like structures contain microtubules. Bars 800 nm (a), 600 nm (b). c Growth rate of third passaged hTERT-transfectants (hTERT P3) and first passaged primary cultures (Primary P1). The growth rate of hTERT P3 was stably maintained up to day 10 after plating, similar to that of Primary P1

Tight junctions in first passaged primary cultured nasal epithelium and third passaged hTERT-transfectants

We investigated the tight junctions in hTERT P3 cells and compared them with those of Primary P1 cells. By RT-PCR, the expression of mRNAs for claudin-1, -2, -4, -5, -6, -7, -8, -9, and -12, occludin, and JAM-A was detected in hTERT P3 cells and Primary P1 cells (Fig. 4a). In Western blots, the expression of proteins of occludin, JAM-A, and claudin-1, -4, and -7 in hTERT P3 cells was similar to that in Primary P1 (Fig. 4b). On immunostaining, claudin-1, -4, occludin, and JAM-A were observed to be expressed at cell borders in hTERT P3 cells (Fig. 4c–f). Furthermore, in hTERT P3, intercellular junction structures including tight junctions were observed at the apical-most membranes by electron microscopy (Fig. 4g).
https://static-content.springer.com/image/art%3A10.1007%2Fs00441-007-0453-z/MediaObjects/441_2007_453_Fig4_HTML.gif
Fig. 4

Tight junctions in third passaged hTERT-transfectants (hTERT P3) compared with first passaged primary cultures (Primary P1). a RT-PCR reveals mRNAs for claudin-1, -2, -4, -5, -6, -7, -8, -9, and -12, occludin, and JAM-A in hTERT P3 cells and Primary P1 cells (M 100-bp ladder DNA marker). b In Western blots, hTERT P3 and Primary P1 cells exhibited similar expression for proteins of occludin, JAM-A, claudin-1, -4, and -7. c–f On immunostaining, claudin-1 (c), -4 (d), occludin (e), and JAM-A (f) were observed at cell borders in hTERT P3 cells. Bars 10 μm. g In transmission electron-microscopic analysis of the hTERT P3, intercellular junction structures including tight junctions were found at the apical-most membranes (arrow). Bar 800 nm

Changes of tight junctions in third passage hTERT-transfectants treated with FBS

To investigate whether hTERT P3 cells had functional tight junctions, the cells were treated with 10% FBS. In Western blots, increases of claudin-1 and -4 were observed at 2 h and 24 h after treatment with 10% FBS (Fig. 5a–c). No changes of claudin-7, occludin, JAM-A, or E-cadherin were detectable (Fig. 5a). The maximum values of TER (indicating the barrier function of tight junctions) were 80±20 Ωcm2. TER was significantly increased from 1 h after treatment with 10% FBS (Fig. 5d).
https://static-content.springer.com/image/art%3A10.1007%2Fs00441-007-0453-z/MediaObjects/441_2007_453_Fig5_HTML.gif
Fig. 5

Changes in expression of tight junction proteins (a–c) and barrier function measured as TER (d) in third passaged hTERT-transfectants before () and after (+) treatment with 10% FBS (FBS). a Western blotting revealed increases of claudin-1 and -4 at 2 h and 24 h after treatment with 10% FBS. b Bar graph of CL-1 expression shown in a. c Bar graph of CL-4 expression shown in a. d Values of TER are significantly increased from 1 h after treatment with 10% FBS. *P < 0.05, **P < 0.01 versus FBS (−)

Changes of tight junctions in third passaged hTERT-transfectants treated with TGF-β

Various cytokines and growth factors, including TGF-β, are thought to affect the human nasal mucosa in nasal polyposis and chronic rhinosinusitis (Pawankar 2003). To investigate the effects of cytokines and growth factors on tight junctions of human nasal epithelial cells, hTERT P3 cells were treated with TGF-β, eotaxin, IL-1β, IL-4, IL-6, IL-13, or TNF-α (10 ng/ml each) for 24 h (Figs. 6, 7; see also supplemental data 3). Since changes of the tight junctions were observed only after treatment with TGF-β, hTERT P3 cells were treated with 0.01–10 ng/ml TGF-β for 24 h. Western blotting demonstrated that the expression of claudin-4 protein increased even at 0.01 ng/ml TGF-β; this increase was dependent on the concentration of TGF-β (Fig. 6a,b). However, no changes in the expression of claudin-1, -7, occludin, JAM-A, or E-cadherin were observed after treatment with TGF-β (Fig. 6a). In RT-PCR, the increase in expression of claudin-4 mRNA was detected from 1 ng/ml TGF-β (Fig. 6c,d). By immunocytochemistry, an increase of claudin-4 immunoreactivity was observed at cell borders in hTERT P3 cells after treatment with 10 ng/ml TGF-β for 24 h, compared with the control (Fig. 7a–c). To investigate the effect of TGF-β on barrier function in hTERT P3 cells, TER in hTERT P3 cells treated with 10 ng/ml TGF-β for 24 h was measured. There was no difference in the TER value between the control and after TGF-β treatment (Fig. 7d).
https://static-content.springer.com/image/art%3A10.1007%2Fs00441-007-0453-z/MediaObjects/441_2007_453_Fig6_HTML.gif
Fig. 6

Changes in expression of tight junction proteins in third passaged hTERT-transfectants after treatment with TGF-β (C control). a Western blotting reveals that the expression of claudin-4 protein increases from 0.01 ng/ml TGF-β, and that the increase is dependent on the concentration of TGF-β. b Bar graph of CL-4 expression shown in a (*P < 0.05, **P < 0.01 versus control). c In RT-PCR, expression of claudin-4 mRNA increases from 1 ng/ml TGF-β. d Bar graph of CL-4 expression shown in c (*P < 0.05 versus control)

https://static-content.springer.com/image/art%3A10.1007%2Fs00441-007-0453-z/MediaObjects/441_2007_453_Fig7_HTML.gif
Fig. 7

Changes in localization of claudin-4 (a–c) and barrier function measured as TER (d) in third passaged hTERT-transfectants after treatment with TGF-β. a–c Immunostaining reveals an increase of claudin-4 immunoreactivity at cell borders in hTERT P3 cells after treatment with 10 ng/ml TGF-β for 24 h, compared with the control. a, b X-Y section. c Z-section. Bars 10 μm. d No differences in TER values are seen between the control and TGF-β treatment

Discussion

In the present study, we have introduced the hTERT gene into primary cultures of human nasal epithelial cells. The ectopic expression of hTERT in human nasal epithelial cells results in cultures with a greater growth potential and a longer lifespan.

The properties of the hTERT-transfected nasal epithelial cells, including tight junctions, are similar to those of the primary cultures. The hTERT-transfected human nasal epithelial cells with an extended lifespan have provided us with an indispensable stable model for studying the regulation of tight junctions in human nasal epithelium.

Properties of passaged hTERT-transfected nasal epithelial cells

The passaged hTERT-transfected human nasal epithelial cells have a cobblestone appearance with greater growth potential and longer lifespan. In the passaged hTERT-transfectants, but not primary cultures, expression of hTERT can be detected by RT-PCR and Western blotting. However, no changes occur in the expression of Ck7 and Ck19 (associated with airway epithelial cytoskeleton), p16 and p53 (contribute to the cell cycle and immortalization), or p73 (regulate hTERT; Beitzinger et al. 2006), compared with primary cultures. On immunostaining, Ck7 and p73, which are expressed in the pseudostratified columnar epithelium of human nasal mucosa in vivo, can be detected in most cells of the primary cultures and passaged hTERT-transfectants. Furthermore, some cilia-like structures, which are differentiated markers of nasal epithelial cells, have been observed on the surface by scanning electron microscopy. These results indicate that the passaged hTERT-transfected human nasal epithelial cells in this culture system are not immortalized but differentiated. The properties of the passaged hTERT-transfectants are comparable with those of the primary cultures. The passaged hTERT-transfectants can easily be frozen and stored in liquid nitrogen for future use (data not shown). This culture system is a promising solution for overcoming the limitations of the existing primary culture system.

Tight junctions in passaged hTERT-transfected nasal epithelial cells

We have previously reported tight junctions in the human nasal mucosa of patients with allergic rhinitis (Takano et al. 2005). The expression of mRNAs of occludin, JAM-A, ZO-1, and claudin-1, -4, -7, -8, -12, -13, and -14 has been detected in tight junctions of the human nasal mucosa. In the pseudostratified columnar epithelium of the nasal mucosa, occludin, JAM-A, and ZO-1 have been found in the uppermost layers, whereas claudin-1, -4, and -7 have been observed throughout the epithelium. In freeze-fracture replicas of the nasal mucosa, continuous tight junction strands form well-developed networks.

In the passaged hTERT-transfectants, we have detected mRNAs for claudin-1, -2, -4, -5, -6, -7, -8, -9, and -12, occludin, and JAM-A and the proteins occludin, JAM-A, claudin-1, -4, and -7. These results are similar to those from primary cultures. Furthermore, intercellular junction structures including tight junctions have been observed at the apical-most membrane in the passaged hTERT-transfectants. These tight junctions are functional, as shown by TER. The maximum value of TER, which indicates the barrier function of tight junctions, is 80±20 Ωcm2 in the passaged hTERT-transfectants. TER is significantly enhanced with an increase of claudin-1 and -4 after treatment with 10% FBS. Overexpression of claudin-1 or claudin-4 is known to increase TER in Madin-Darby-canine kidney (MDCK) II cells (McCarthy et al. 2000; Van Itallie et al. 2001). Furthermore, in human nasal epithelial cells in vitro, Yoo and colleagues have reported that serially passaged human nasal epithelial cells show high TER values up to passage 4 (Yoo et al. 2003; Lin et al. 2005). Since the passaged hTERT-transfectants in the present study exhibit the expression and function of tight junctions, like those of primary cultures, they can be employed to for study the mechanisms of the regulation of tight junctions in human nasal epithelium.

Induction of claudin-4 by TGF-β in passaged hTERT-transfected nasal epithelial cells

We have treated the passaged hTERT-transfectants with TGF-β, eotaxin, IL-1β, IL-4, IL-6, IL-13, and TNF-α, which are involved in the pathogenesis of nasal polyposis and chronic rhinosinusitis (Pawankar 2003). Of the cytokines and growth factors, only TGF-β has been observed to upregulate the expression of claudin-4 without a change of barrier function (Figs. 6, 7; see also supplemental data 3). TGF-β is a multifunctional cytokine with immunosuppressive properties produced by many cell types and can enhance intestinal epithelial barrier function (Howe et al. 2005). In our experiments, the TER of hTERT-transfectants is enhanced by an increase of claudin-1 and -4 after treatment with 10% FBS. Although the detailed mechanisms for the regulation of human nasal epithelial barrier are unclear, the upregulation of not only claudin-4, but also claudin-1 may be necessary to induce barrier function. In contrast, TGF-β-induced epithelial-to-mesenchymal transition is associated with a loss of claudin-1, claudin-2, occludin, and E-cadherin in MDCK cells (Medici et al. 2006). TGF-β may also be important for the regulation of tight junctions in human nasal epithelial cells.

Some members of the claudin family have been shown to confer ion selectivity to the paracellular pathway (Van Itallie and Anderson 2006). Claudin-4 selectively decreases the permeability of cations through tight junctions (Schneeberger 2003). On the other hand, claudin-4 is known as a receptor for CPE (Katahira et al. 1997; Fujita et al. 2000), which can bind to claudin-3, -4, -6, -7, -8, and -14, but not to claudin-1, -2, -5, and -10, via an extracellular second loop (Fujita et al. 2000). Furthermore, C-terminal parts of CPE (C-CPE) modulate the barrier function of claudin-4 (Sonoda et al. 1999). These findings suggest that claudin-4 induced by TGF-β in the passaged hTERT-transfected human nasal epithelial cells may be a novel target for a drug delivery system through the nasal epithelium, by using a selective paracellular pathway or the claudin modulator C-CPE (Kondoh et al. 2006).

Concluding remarks

In the present study, we have introduced the hTERT gene into primary cultures of human nasal epithelial cells. The passaged hTERT-transfected human nasal epithelial cells from limited human nasal cell sources show adequate growth potential and a longer lifespan. The hTERT-transfected human nasal epithelial cells with an extended lifespan provide us with an indispensable and stable model for studying the regulation of claudins in human nasal epithelium.

Acknowledgments

We thank Ms. E. Suzuki (Sapporo Medical University) for technical support.

Supplementary material

Copyright information

© Springer-Verlag 2007