Parasitology Research

, Volume 92, Issue 1, pp 22–29

Polymerase chain reaction-based genotype classification among human Blastocystis hominis populations isolated from different countries

Authors

    • Department of Biological Science, Faculty of ScienceNara Women’s University
  • Zhiliang Wu
    • Department of ParasitologyGifu University School of Medicine
  • Isao Kimata
    • Department of Medical ZoologyOsaka City University Graduate School of Medicine
  • Motohiro Iseki
    • Department of Parasitology, Graduate School of Medical ScienceKanazawa University
  • Ibne Karim M. D. Ali
    • International Centre for Diarrhoeal Diseases Research
    • Department of Infectious and Tropical DiseasesLondon School of Hygiene and Tropical Medicine
  • Momammad B. Hossain
    • International Centre for Diarrhoeal Diseases Research
  • Viqar Zaman
    • Department of MicrobiologyAga Khan University
  • Rashidul Haque
    • International Centre for Diarrhoeal Diseases Research
  • Yuzo Takahashi
    • Department of ParasitologyGifu University School of Medicine
Original Paper

DOI: 10.1007/s00436-003-0995-2

Cite this article as:
Yoshikawa, H., Wu, Z., Kimata, I. et al. Parasitol Res (2004) 92: 22. doi:10.1007/s00436-003-0995-2

Abstract

Since the genotype of human Blastocystis hominis isolates is highly polymorphic, PCR-based genotype classification using known sequenced-tagged site (STS) primers would allow the identification or classification of different genotypes. Five populations of human B. hominis isolates obtained from Japan, Pakistan, Bangladesh, Germany, and Thailand were subjected to genotype analysis by using seven kinds of STS primers. Ninety-nine out of 102 isolates were identified as one of the known genotypes, while one isolate from Thailand showed two distinct genotypes and two isolates from Japan were negative with all the STS primers. The most dominant genotype among four populations, except for all four isolates from Thailand, was subtype 3 and it varied from 41.7% to 92.3%. The second most common genotype among four populations was either subtype 1 (7.7–25.0%) or subtype 4 (10.0–22.9%). Subtype 2, subtype 5, and/or subtype 7 were only rarely detected among the isolates from Japan and Germany, while subtype 6 was not detected. The phylogenetic position of the two isolates which were negative with all STS primers, was inferred from the small subunit rRNA (SSU rRNA) genes with the known sequence data of 20 Blastocystis isolates. Since the two isolates were positioned in an additional clade in the phylogenetic tree, this suggested they were a new genotype. These results demonstrated that PCR-based genotype classification is a powerful tool with which to analyse genotypes of Blastocystis isolates obtained from clinical samples. In addition, two groups of the isolates from 15 symptomatic and 11 asymptomatic patients in Bangladesh were compared with the PCR-based subtype classification. Since both groups were only classified into two distinct genotypes of subtype 1 or subtype 3 and no statistically significant difference was observed between the two groups, in this study it could not be shown that the specific genotype correlated with the pathogenic potential of B. hominis.

Introduction

Blastocystis hominis is one of the most common protozoan parasites of the human intestinal tract (Windsor et al. 2002). Although many symptomatic cases without any other detective agent have been reported in many countries, Blastocystis infections are very common in many healthy people without any symptoms (Stenzel and Boreham 1996). Therefore, the pathogenic potential of this parasite is still controversial. On the basis of our molecular epidemiological study and the results of traditional epidemiology among family members and small communities, the faecal-oral route is considered to be the transmitting mode among humans (Nimri et al. 1993; Galantowicz et al. 1993; Stenzel and Boreham 1996; Yoshikawa et al. 2000). Circumstantial evidence of many zoonotic strains identified from a wide range of mammals and birds suggests that there is another infectious route between animal and humans (Yoshikawa et al. 1996, 2003; Clark 1997; Abe et al. 2003a, 2003b, 2003c; Noel et al. 2003). This transmission route is likely, because animal handlers showed a significantly higher rate of infection with B. hominis (Salim et al. 1999). Since extensive genetic and karyotypic heterogeneity have been demonstrated among Blastocystis isolates from humans and animals (Upcroft et al. 1989; Yoshikawa et al. 1996, 1998, 2000, 2003; Clark 1997; Böhm-Gloning et al. 1997; Carbajal et al. 1997; Chen et al. 1997; Hoevers et al. 2000; Ho et al. 2001; Abe et al. 2003a, 2003b, 2003c; Arisue et al. 2003; Noel et al. 2003), it has been postulated that certain demes or genetically distinct genotypes of B. hominis may exhibit pathogenicity. Since there is no suitable animal model available for B. hominis infection at present, the pathogenic potential of B. hominis cannot be demonstrated experimentally (Tan et al. 2002). Therefore, comparative studies of human B. hominis populations from geographically separate countries or of isolates from clinically symptomatic and asymptomatic patients may reveal a possible correlation between certain genotypes and the pathogenic potential of this parasite. Although there have been a few trials which have examined genotypes correlating with the pathogenic potential of this parasite, using the restriction fragment length polymorphism (RFLP) analysis of a small subunit rRNA gene (SSU rDNA), so-called riboprinting, there was only a possible relationship or no distinct differences in genotypes (ribodemes) between isolates from symptomatic and asymptomatic groups (Böhm-Gloning et al. 1997; Kaneda et al. 2001). Moreover, a recent sequence study of the SSU rDNAs of a wide range of Blastocystis isolates from humans and animals revealed that it could not be guaranteed that the same RFLP profile would always show the same sequence (Arisue et al. 2003). Therefore, RFLP analysis of SSU rDNA is not a suitable tool for the identification or classification of the genotypes of B. hominis. In this study, therefore, genotypic classification was performed by using sequenced-tagged site (STS) primers (Yoshikawa et al. 1998, 2000, 2003). The STS primers developed from random amplified polymorphic DNA (RAPD) analysis of known strains of B. hominis only amplified the distinct subtypes which correspond to the phylogenetically different clades inferred from the SSU rDNA sequences (Arisue et al. 2003; Yoshikawa et al. 2003). Moreover, this PCR-based technique has recently been reported as a practical tool for typing B. hominis isolates from humans and animals and for the detection of zoonotic genotypes from animals (Yoshikawa et al. 1998, 2000, 2003; Abe et al. 2003a, 2003b, 2003c). Therefore, negative PCR results using the STS primers may lead to the identification of new genotype(s), which will promote further classification of unknown Blastocystis genotypes. Finally, a new genotype of human B. hominis isolates was detected in this study.

Materials and methods

Sources and isolation of B. hominis

The faecal specimens of patients were obtained from the routine faecal examination unit of the hospital or parasitology laboratory at Osaka City University Medical School, Japan, Khon Kaen University, Thailand, and Bonn University, Germany, respectively. In Pakistan, the faecal samples were obtained from symptomatic patients with gastrointestinal symptoms admitted to a hospital at the Aga Khan University. The history and background of the samples could not be obtained from each university. The faecal samples collected from patients of the outpatient department at the International Centre for Diarrhoeal Disease Research in Bangladesh were classified into symptomatic and asymptomatic groups based on the following criteria. Asymptomatic patients were healthy without any gastrointestinal symptoms. Symptomatic patients had diarrhoea or dysentery, but were negative for parasitic tests for Entamoeba histolytica, Giardia lamblia , and helminth eggs etc. and bacteriological tests for Salmonella sp., Shigella sp. and Vibrio sp. However, patients could not be examined for the presence of Cryptosporidium sp. and enteric viruses due to technical reasons.

The faecal specimens were cultured in Ringer’s solution containing 10% horse serum and 0.05% asparagine or in Jones’ medium (Jones 1946) containing 10% horse serum at 37°C. The screening of Blastocystis organisms in 3- to 4-day-old cultures was done with standard light microscopy. When the typical vacuolar or granular forms of Blastocystis organisms were observed, they were subcultured in a new medium. After one or two subcultures, B. hominis suspensions were centrifuged at 12,000 g for 1 min and packed organisms were frozen at −20°C until the DNA was extracted. In this study, 10, 18, 9, and 13 isolates of B. hominis were obtained from 498, 515, 673, and 351 faecal samples from 1999 to 2002, respectively, in Japan, 12 isolates were obtained from 67 stool samples in 2000 in Germany, and four isolates were obtained from 30 stool samples in 2000 in Thailand.

Genomic DNA preparation

Genomic DNA of B. hominis was extracted by using DNAzol (Gibco BRL/Life Technologies, Grand Island, N.Y.) according to the manufacturer’s protocol.

Typing by PCR with the STS primers

The specific STS primers developed from the RAPD products have been developed for typing the subtypes among Blastocystis isolates from humans and animals, and also have identified many zoonotic isolates from a wide range of animals (Yoshikawa et al. 1998, 2000, 2003; Abe et al. 2003a, 2003b, 2003c). In this study, therefore, typing from subtype 1 to subtype 7 was achieved by using PCR amplification on the basis of the presence or absence of the products within a parallel with a control PCR amplification (Table 1). Control subtypes of B. hominis from which the primers were developed were used in this study. Namely, strains Nand II, B, HV93–13, HJ96AS-1, HJ96–1, SY94–3, and RN94–9 were used for subtypes 1–7, respectively (Yoshikawa et al. 1998, 2000, 2003). The PCR conditions when using the specific primers and electrophoresis of PCR products were the same as described previously (Yoshikawa et al. 2000). The PCR amplification for each primer pair was repeated at least thrice. When the PCR product showed a weak band or no band, the isolates were subjected to sequencing of the full-length SSU rRNA gene to confirm the genotype(s).
Table 1

Subtype classification with the sequence-tagged site (STS) primer sets used in this study. SSU rRNA Small subunit rRNA

Subtypes

STS primer sets

Product size (bp)

Sequences of forward (F) and reverse (R) primers (5′– 3′)

Source of primer

GenBank accession no.

Reference

Clade in the SSU rRNA phylogenya

1

SB83

351

F

GAAGGACTCTCTGACGATGA

Nand II

AF166086

Yoshikawa et al. (1998)

I

R

GTCCAAATGAAAGGCAGC

2

SB155

650

F

ATCAGCCTACAATCTCCTC

B

AF166087

VII

R

ATCGCCACTTCTCCAAT

3

SB227

526

F

TAGGATTTGGTGTTTGGAGA

HV93–13

AF166088

Yoshikawa et al. (2000)

III

R

TTAGAAGTGAAGGAGATGGAAG

4

SB332

338

F

GCATCCAGACTACTATCAACATT

HJ96AS-1

AF166091

VI

R

CCATTTTCAGACAACCACTTA

5

SB340

704

F

TGTTCTTGTGTCTTCTCAGCTC

HJ96–1

AY048752

Yoshikawa et al. (2003)

II

R

TTCTTTCACACTCCCGTCAT

6

SB336

317

F

GTGGGTAGAGGAAGGAAAACA

SY94–3

AY048751

V

R

AGAACAAGTCGATGAAGTGAGAT

7

SB337

487

F

GTCTTTCCCTGTCTATTCTGCA

RN94–9

AY048750

IV

R

AATTCGGTCTGCTTCTTCTG

aEach clade determined by SSU rRNA genes (Arisue et al. 2003) corresponds to a distinct subtype (Yoshikawa et al. 2003)

Sequencing of the SSU rRNA genes

The SSU rRNA genes were amplified using a pair of sense (SR1F) and anti-sense (SR1R) primers (Yoshikawa et al. 2000). These primer pairs produced an approximately 1,800-bp product. The PCR amplification was performed with 35 cycles of 94°C for 40 s, 57°C for 60 s, and 72°C for 2 min, after an initial denaturation at 94°C for 3 min. The PCR products were purified with a Geneclean II kit (Bio 101, Buena Vista, Calif.) and DNA fragments were ligated into a pT7Blue T-Vector (Novagen, EMD Biosciences, Wis.). The recombinant plasmids were introduced into competent cells of Escherichia coli JM 109. The plasmid DNA was isolated from E. coli using a FlexiPrep kit (Amersham Biosciences, N.J.). The DNA sequence was determined by using a Thermo Sequenase cycle sequencing kit (USB, Ohio) and an automatic sequencer (model LIC-4200; Aloka, Tokyo). Since the sequence variations of different clones of ligated DNA fragments have been placed within an independent clade without exception (Arisue et al. 2003), only one clone of each isolate was sequenced in this study. The sequence data was analysed using DNASIS software (Hitachi Software Engineering, Tokyo).

Sequence alignment and phylogenetic reconstruction analysis

The five sequences of the SSU rRNA genes obtained in this study were aligned manually with the previously published data of the SSU rRNA gene of Blastocystis isolates and of Proteromonas lacertae by using the maximum likelihood method as described previously (Arisue et al. 2003). The GenBank accession numbers for the sequences used in this study are shown in the phylogenetic tree.

Results

It is generally considered that developing counties show a higher prevalence of B. hominis than developed countries (Stenzel and Boreham 1996). Although a sufficient number of stool samples could not obtained in Germany and Thailand during the short duration of the study, the prevalence of B. hominis in Japan (1.3–3.5% during 3 years) was quite low compared with 17.9% (12/67) and 13.3% (4/30) prevalence in Germany and Thailand, respectively. Moreover, it is evident that the mean prevalence of 2.45% (50/2,037) in Japan during the past 3 years was quite low compared with the prevalence of 6.9% (96/1,390) in Wales shown by examination of samples by the Trichrome staining method (Windsor et al. 2002). Even when we employed the culture examination, which is known to be sensitive for the detection of B. hominis compared with the routine examination of stool samples (Zaman and Khan 1994; Leelayoova et al. 2002), the prevalence of 2.45% in Japan was very low among those reported for developed countries (Stenzel and Boreham 1996).

In contrast, the prevalence in developing countries such as Pakistan and Bangladesh is relatively high (Zaman and Khan 1994), but it is difficult to exclude the potential effects of other microbes causing gastrointestinal symptoms. In this study, therefore, the symptomatic patients in Bangladesh were checked for the following microbes; Entamoeba histolytica, Giardia lamblia , helminth eggs, Salmonella sp., Shigella sp., and Vibrio sp. and only negative samples were used in this study. Since each STS primer specifically amplified distinct B. hominis genotypes, elimination of concomitant bacteria or other common intestinal Protozoa in cultures was not necessary before the extraction of genomic DNA (Yoshikawa et al. 1998, 2000, 2003). Therefore, when Blastocystis organisms were found in the cultures by standard light microscopy, DNA was extracted without prior washing steps. These genomic DNAs were screened with PCR amplification using the seven sets of primer pairs to identify genotypes of B. hominis. Positive PCR amplification with each primer set was identified through gel electrophoresis by running a positive control for each primer pair (Fig. 1).
Fig. 1

Example of PCR amplification of several Blastocystis hominis isolates with the sequenced-tagged site (STS) primers SB83 (A), SB155 (B), SB227 (C), SB332 (D), SB340 (E), and SB337 (F) with a positive PCR product of the control strain (lane 1) as listed in Table 1. The isolate HT01–1 (lane 15) is amplified with both SB83 (A) and SB227 (C), while other isolates are amplified with only one of the STS primers except for two isolates, HJ00–4 (lane 4) and HJ00–5 (lane 5), which are negative with all primers. Although the isolates HJ01–7 (lane 3) and HG00–3 (lane 13) show a distinct amplicon with the primer SB337 (F), HG00–12 (lane 14) shows a weak band with the same primer. M Molecular marker (100-bp ladder), 1 positive control, 2 HJ99–9, 3 HJ01–7, 4 HJ00–4, 5 HJ00–5, 6 HB00–1, 7 HB00–2, 8 HB00–8, 9 HP00–1, 10 HP00–3, 11 HP00–5, 12 HG00–4, 13 HG00–10, 14 HG00–12, 15 HT00–1, 16 HT00–2, 17 HT00–3 {the first two letters of each isolates’ name indicate the origin [human (H)] and country [Japan (J), Bangladesh (B), Pakistan (P), Germany (G), Thailand (T)] from which the organism was isolated, and the numbers indicate the year [1999 (99), 2000 (00), 2001 (01)] in which the isolate was found. The number following the hyphen indicates the position of that particular isolate in that year’s series}

When 102 isolates were screened with the seven kinds of STS primers listed in Table 1, ninety-nine isolates were amplified with only one of the distinct STS primers (Table 2). On the other hand, isolate HT00–1 obtained from Thailand showed positive amplification with both SB83 and SB227 primers (Fig. 1A, C). Therefore, this isolate was judged to be a mixed isolate containing two distinct genotypes of subtype 1 and subtype 3 (Table 2). In contrast, the remaining two isolates, HJ00–4 and HJ00–5, obtained from Japan were not amplified with any STS primer (Table 2, Fig. 1).
Table 2.

Subtype classification of Blastocystis hominis populations isolated from five geographically different countries determined by STS primers

Countries

Total no. of isolates

Subtype classification (% in parentheses)

1

2

3

4

5

6

7

Unknown

Japan

50

4 (8.0)

5 (10.0)

26 (52.0)

11 (22.0)

0

0

2 (4.0)

2 (4.0)

Bangladesh

26 a

2 (7.7)

0

24 (92.3)

0

0

0

0

0

Pakistan

10

2 (20.0)

0

7 (70.0)

1 (10.0)

0

0

0

0

Germany

12

3 (25.0)

0

5 (41.7)

0

2 (16.7)

0

2 (16.7)

0

Thailand

4 c

2 b

0

2 b

1

0

0

0

0

Total

102

13 c

5

64 c

13

2

0

4

2

aComprised two groups of isolates from the symptomatic and asymptomatic patients listed in Table 3

bSince isolate HT00–1 obtained from Thailand was amplified with both STS primers SB83 and SB227, this isolate comprised two distinct genotypes: subtype 1 and subtype 3 of Blastocystis

cComprised mixed genotypes of HT00–1, hence the total number of subtype 1 and subtype 3 does not correspond with the total number of isolates or the total number of isolates in Thailand

Based on the PCR amplification, the most dominant genotype observed in the four populations obtained from Japan, Bangladesh, Pakistan, and Germany was subtype 3, and its prevalence ranged from 41.7% to 92.3% among the four countries (Table 2). Since only four isolates were obtained in Thailand during the short duration of the study, it is difficult to evaluate the results of these four isolates. When the data for subtype 3 were subjected to the χ2-test, its prevalence was shown to be different among the four countries (P <0.05). The next most common genotypes among the four countries were either subtype 1 or subtype 4. The prevalence of these subtypes between the countries varied from 7.7% to 25.5% and from 10.0% to 22.0%, respectively (Table 2). However, the data for these subtypes cannot be analysed by statistical methods because the sample sizes were too small. Since the remaining subtypes, 2, 5, and 7, were only detected at rates of from 4.0–16.7%, these subtypes were considered rare genotypes. Subtype 6 was not detected in this study.

Based on PCR amplification with the STS primers, only one isolate, HG00–12, among the three isolates amplified with the primer SB337 showed a weak band of the amplicon (Fig. 1F), while there were two isolates (HJ00-4 and HJ00–5) negative with all STS primers (Fig. 1). Therefore, phylogenetic analysis of these five isolates was employed to confirm their genotypes. Based on the SSU rRNA phylogeny with the known 20 Blastocystis isolates (Arisue et al. 2003), all three isolates amplified with the primer SB337, i.e. HJ01–7, HG00–10, and HG00–12, were placed into the monophyletic clade IV including RN94–9, NIH:1295–1, and a guinea pig isolate, while the unknown genotype of the two isolates HJ00–4 and HJ00–5 was clustered into an additional monophyletic clade in the phylogenetic tree with a 100% bootstrap value (Fig. 2). Therefore, all three isolates amplified with the primer SB337 were confirmed to belong to clade IV and the results were corroborated with those of subtype 7 (Table 1). In contrast, the other two isolates, HJ00–4 and HJ00–5, which were negative with all the STS primers, showed an additional new clade in the phylogenetic tree (Fig. 2). This result indicates that these two isolates represent a new genotype among the polymorphic genotypes of B. hominis populations (Arisue et al. 2003).
Fig. 2

Phylogenetic tree of the small subunit rRNA (SSU rRNA) sequences of five isolates combined with the known sequence data of 20 Blastocystis isolates with Proteromonas lacertae as the outgroup. The best tree analysed by the maximum likelihood method is shown with the bootstrap proportion (%). For the bootstrap proportions corresponding to the internal branches within clade I up to and including clade VII, only those with >70% support are shown. In total 1,381 unambiguously aligned positions were selected and used. The two isolates which were negative with all STS primers, HJ00–4 and HJ00–5, are clustered into an additional monophyletic clade (➙), while all three isolates amplified with the primer SB337, HJ01–7, HG00–10, and HG00–12, are placed into the monophyletic clade IV including RN94–9, NIH-1295–1, and a guinea pig isolate which are designated as subtype 7 (Table 1). Each monophyletic clade from I to VII corresponded to the phylogenetic clades reported previously (Arisue et al. 2003). The accession numbers in the GenBank are shown in parentheses. The length of each branch is proportional to the estimated number of substitutions

In order to analyse the pathogenic potential of the distinct genotype(s) of B. hominis, two groups of isolates from symptomatic and asymptomatic patients in Bangladesh were compared in the subtype classification. Tentatively, the isolates recovered from 11 normal healthy individuals without any gastrointestinal symptoms were categorized as the non-pathogenic isolates of B. hominis, while the isolates from 15 patients with diarrhoea or dysentery without other pathogenic protozoans, helminths, and bacterial pathogens examined in this study were categorized as the pathogenic isolates. Based on the PCR amplification, both groups of isolates showed only two distinct genotypes, subtype 1 and subtype 3 (Table 3). Since Fisher’s exact probability test could not show any differences between these groups, there was no correlation between the distinct genotype and pathogenic potential of this parasite.
Table 3

Subtype classification of two populations of B. hominis isolates from the symptomatic and asymptomatic patients in Bangladesh

Patients

Total no. of isolates

Subtype classification (% in parentheses)

1

2

3

4

5

6

7

Symptomatic

11

1 (9.1)

0

10 (90.9)

0

0

0

0

Asymptomatic

15

1 (6.7)

0

14 (93.3)

0

0

0

0

Discussion

It is still controversial whether B. hominis is a pathogenic or a commensal organism, because there are many conflicting reports on the pathogenic potential of B. hominis infection. In a trial using an immunological approach, antigenic heterogeneity had been detected among B. hominis isolates from symptomatic and asymptomatic patients (Lanuza et al. 1999), while there were no significant differences in populations of the serotypes between the isolates from the symptomatic and asymptomatic patients (Kukoschke and Müller 1991). Although significant differences in the antibody response have been reported between symptomatic patients and asymptomatic or healthy people, there is no information available about the genotypes of B. hominis in these studies (Zierdt et al. 1995; Hussain et al. 1997).

Since the human B. hominis population is genetically highly polymorphic (Yoshikawa et al. 1996, 1998, 2000, 2003; Clark 1997; Böhm-Gloning et al. 1997; Hoevers et al. 2000; Ho et al. 2001; Kaneda et al. 2001; Arisue et al. 2003; Noel et al. 2003), it is generally assumed that the specific deme or genotype of the parasite may contribute to its pathogenic potential. Therefore, it is important to show the variation of genotypes to take into account the pathogenic potential of this parasite. In this study, therefore, a PCR-based methodology was applied to classify the genotypes of five geographically different human populations of B. hominis. In our previous studies, several STS primers developed from RAPD products of the distinct genotypes have been used to successfully classify and identify seven kinds of the genotypes by PCR analysis and each genotype corroborated the phylogenetic relationship (Yoshikawa et al. 1998, 2000, 2003). Moreover, the STS primers could identify many zoonotic isolates from various animals such as cattle, pigs, monkeys, and birds (Abe et al. 2003a, 2003b, 2003c). Therefore, it is evident that the STS primers can be used as a tool to type genotypes among polymorphic Blastocystis populations.

In the present study, the most dominant genotype was subtype 3 among the four populations of B. hominis isolated from Japan, Bangladesh, Pakistan, and Germany (Table 2). Besides the other genotypes which could not be analysed with the χ2-test, subtype 2, subtype 5, and/or subtype 7 were only detected among the isolates from Japan and Germany, while these genotypes were not present in the isolates from the symptomatic patients in Bangladesh and from Pakistan. Therefore, the genotypes of the subtypes 2, 5, and 7 appeared to be non-pathogenic ones.

In the previous phylogenetic study using sequences of SSU rRNA genes among 20 Blastocystis isolates, clade III corresponded to subtype 3 amplified with the primer SB227 and only comprised those of human origin (Arisue et al. 2003). Interestingly, a recent PCR-based genotype analysis among many isolates from a wide range of animals using the same STS primers identified three zoonotic isolates of subtype 3 from cattle and pigs (Abe et al. 2003a, 2003b, 2003c). Therefore, subtype 3 is not a specific genotype showing a human origin. On the other hand, other zoonotic subtypes have been frequently isolated from various animals (Abe et al. 2003a, 2003b; Arisue et al. 2003; Yoshikawa et al. 2003) indicating the difficulty of identifying the transmission route be it either human-to-animal or animal-to-human. In contrast, subtype 3 is the most dominant genotype among human isolates from four counties (41.7–92.3%), while it is rare in animals, suggesting that it may spread from human to animals.

In this study, HJ01–7, HG00–10, and HG00–12 isolates amplified with the primer SB337 were placed within clade IV inferred from the SSU rRNA genes (Fig. 2). Interestingly two strains, NIH:1295–1 and RN94–9, isolated from a guinea pig and a laboratory rat, respectively, were placed in this same clade (Arisue et al. 2003) and both strains were also recently demonstrated to have the same genotype as subtype 7 (Table 1) (Yoshikawa et al. 2003). Since there have been no data of human isolates of genotype 7, it is evident that clade IV is the true zoonotic genotype in this study. In addition, the same STS primer had recently amplified all three isolates from rats in Singapore (Yoshikawa et al. 2003). Therefore, these results reconfirmed the finding that the three isolates from rats were zoonotic B. hominis, although these three isolates were originally reported as Blastocystis ratti on the basis of electrophoretic karyotyping analysis (Chen et al. 1997). These discrepancies also indicate that karyotypic heterogeneity among Blastocystis isolates does not support species differences. On the other hand, subtype 2, subtype 4, and subtype 5 have been demonstrated as zoonotic genotypes based on PCR amplification with the STS primers and the SSU rRNA phylogeny (Arisue et al. 2003; Yoshikawa et al. 2003). Since subtype 1 has been proposed as the first zoonotic subtype (Yoshikawa et al. 1996) and it was reconfirmed by a phylogenetic study (Arisue et al. 2003), all subtypes detected in this study are zoonotic genotypes. Therefore, the STS primers can be used for the identification of the zoonotic genotypes (Abe et al. 2003a, 2003b, 2003c).

In our previous phylogenetic study of the SSU rRNA genes among Blastocystis isolates from humans and animals, seven different monophyletic clades were supported by a 100% bootstrap value (Arisue et al. 2003). In this study, two isolates, HJ00–4 and HJ00–5, were not only negative with all STS primers in the PCR analysis but also the SSU rRNA phylogeny showed an additional monophyletic clade of both isolates supported by a 100% bootstrap value (Fig. 2). Therefore, it is evident that these isolates are a new genotype. The present study indicates that the PCR analysis using the STS primers is a practical tool with which to classify and identify genotypes and also to find unknown genotype(s) in clinical isolates of B. hominis. In addition, it is important to carry out a survey of B. hominis to find new genotype(s), and further study will facilitate an understanding of genomic polymorphism among B. hominis populations and the zoonotic potential of those of animal origin.

It is still debated whether distinct genotype(s) of human B. hominis correlate with the pathogenic potential of this parasite. In this study, therefore, two populations of B. hominis isolated from the symptomatic and asymptomatic patients in Bangladesh were compared with the genotype classification. However, no significant differences in distribution of the genotype between the two populations were observed when using Fisher’s exact probability test (Table 3). Therefore, in this study it could not be shown that specific genotype(s) correlated with the pathogenic potential of B. hominis. In a recent genetic study of clinical isolates of Leishmania aethiopica, PCR-RFLP and RAPD analyses did not show any correlation between genetic differences and clinical variations of cutaneous leishmaniasis (Schonian et al. 2000). Therefore, it seems that it may be difficult to detect the relationship between the pathogenicity and distinct genotype of human B. hominis.

Acknowledgements

We express our gratitude to Dr S. Tesana, Khon Kaen University, Thailand and Dr H. M. Seiz, Bonn University, Germany for collecting the faecal samples in Thailand and Germany, respectively, and thank Dr T. Hashimoto, University of Tsukuba for the phylogenetic analysis. This work was supported by a grant from the Japan Society for the Promotion of Science to H. Y. (C-13670245) and by a grant from ICDDR, B Centre for Health and Population Research with the support of the University of Virginia (NIH grant, AI-43596) to A. I.

Copyright information

© Springer-Verlag 2004