Medical Microbiology and Immunology

, Volume 200, Issue 1, pp 39–49

Prevalence and characteristics of hepatitis B and C virus infections in treatment-naïve HIV-infected patients

Authors

    • Clinic of Gastroenterology, Hepatology and Infectious DiseasesUniversity Hospital
  • Mark Oette
    • Clinic of General Medicine, Gastroenterology and Infectious DiseasesAugustinerinnen Hospital
  • Frank Clemens Wilhelm
    • Institute of VirologyUniversity of Cologne
  • Bastian Beggel
    • Max Planck Institute for Informatics, Computational Biology and Applied Algorithmics
  • Rolf Kaiser
    • Institute of VirologyUniversity of Cologne
  • Melanie Balduin
    • Institute of VirologyUniversity of Cologne
  • Finja Schweitzer
    • Institute of VirologyUniversity of Cologne
  • Jens Verheyen
    • Institute of VirologyUniversity of Cologne
  • Ortwin Adams
    • Institute of VirologyUniversity Hospital of Düsseldorf
  • Thomas Lengauer
    • Max Planck Institute for Informatics, Computational Biology and Applied Algorithmics
  • Gerd Fätkenheuer
    • Department of Internal Medicine IUniversity Hospital of Cologne
  • Herbert Pfister
    • Institute of VirologyUniversity of Cologne
  • Dieter Häussinger
    • Clinic of Gastroenterology, Hepatology and Infectious DiseasesUniversity Hospital
Original Investigation

DOI: 10.1007/s00430-010-0172-z

Cite this article as:
Reuter, S., Oette, M., Wilhelm, F.C. et al. Med Microbiol Immunol (2011) 200: 39. doi:10.1007/s00430-010-0172-z

Abstract

In HIV-infected treatment-naïve patients, we analyzed risk factors for either chronic hepatitis B (HBV) infection, occult HBV infection (OHBV) or a positive hepatitis C (HCV) serostatus. A total of 918 patients of the RESINA-cohort in Germany were included in this study. Before initiating antiretroviral therapy, clinical parameters were collected and blood samples were analyzed for antibodies against HIV, HBV and HCV, HBs antigen and viral nucleic acids for HIV and HBV. Present or past HBV infection (i.e. HBsAg and/or anti-HBc) was found in 43.4% of patients. HBsAg was detected in 4.5% (41/918) and HBV DNA in 6.1% (34/554), resulting in OHBV infection in 2.9% (16/554) of patients. OHBV infection could not be ruled out by the presence of anti-HBs (50.1%) or the absence of all HBV seromarkers (25%). A HCV-positive serostatus was associated with the IVDU transmission route, non-African ethnicity, elevated liver parameters (ASL or GGT) and low HIV viral load. Replicative HBV infection and HCV-positive serostatus both correlated with HIV resistance mutations (P = 0.001 and P = 0.028). HBV and HCV infection are frequent co-infections in HIV treatment-naive patients. These co-infections influence viral evolution, clinical parameters and serological markers. Consequently, HIV patients should routinely be tested for HBV and HCV infection before initiating HIV treatment. OHBV infection constituted almost half of all HBV infections with detectable HBV DNA. Due to a lack of risk factors indicating OHBV infection, HBV diagnosis should not only include serological markers but also the detection of HBV DNA.

Keywords

HBVHCVCo-infectionResistance mutationsOccult infection

Introduction

Liver disease has become a leading cause of disease progression, morbidity and mortality in HIV-infected patients. In this context, hepatitis B virus (HBV) or hepatitis C virus (HCV) are frequently causing liver disease, as these infectious agents share modes of transmission with HIV [1, 2]. Furthermore, HBV and HCV co-infections increase the risk of hepatotoxicity caused by HIV antiretroviral treatment regimens [3].

Prevalence of HBV co-infection and the presence of HBV serological markers depend on epidemiology and the route of infection [4, 5]. Chronic HBV infection is defined by the persistence of HBsAg for more than 6 months and is usually accompanied by detectable HBV DNA. HBV infection in immunocompetent HIV-negative persons results rarely in chronification (<10%), while in HIV co-infection, chronification is more frequent and is associated with a rapid progression to cirrhosis [6, 7].

In some cases, HBV replication with detectable HBV DNA occurs in the absence of HBsAg, termed occult HBV (OHBV) infection. The underlying mechanisms of OHBV infection have not been elucidated yet [812]. Variation within prevalences of OHBV infection in HIV-infected individuals has been observed [4, 5, 1315]. Some substances included in HIV-treatment regimens are also active against HBV; treatment should therefore be initiated concomitantly.

The goal of this study was to identify subgroups of patients with an increased risk for HBV chronification. The prevalence of OHBV infection in HIV-infected patients was determined and possible risk factors were analyzed.

The prevalence of HCV–HIV co-infected patients in western countries is 30% [3]. HCV disease course, increasing HCV viral load, severity of liver disease and progression to cirrhosis and liver failure is known to be influenced by HIV infection. It remains a matter of debate to what extent HCV co-infection influences the natural course of HIV infection [3, 16, 17]. The determination of the impact and frequency of HCV co-infection as well as possible risk factors is important for screening and appropriate treatment choices.

Few data are available on HBV or HCV co-infection in treatment-naïve HIV patients. To improve the understanding of the epidemiology and the possible risk factors of both infections, the prevalence and distribution of serological and molecular markers for HBV and HCV were analyzed in a large multicenter cohort of treatment-naive HIV patients (RESINA cohort) [18]. Furthermore, patterns of transmitted resistance in HIV and HBV infection were analyzed and correlated with clinical parameters.

Methods

Patients

RESINA is a large prospective and well-characterized cohort of treatment-naive HIV-infected patients in North Rhine-Westphalia, Germany (n = 2,000) [18]. At baseline, a HIV resistance analysis is performed. Out of the RESINA cohort, all treatment-naive HIV patients from the two largest recruiting centers (i.e. from the University Hospitals of Cologne and Düsseldorf) were included in this study (n = 918). Clinical and epidemiological parameters included age, gender, mode of transmission, ethnicity, and CDC stage. Basic laboratory values included lymphocyte typing, AST, ALT, GGT, AP, LDH, total bilirubin, and complete blood cell count.

Serological analysis

Commercial serological assays from ABBOTT (Architect and Axsym, ABBOTT Wiesbaden, Germany) were used for the determination of HBsAg (n = 918), anti-HBs (n = 842), anti-HBc (n = 918) and anti-HCV (n = 918).

Determination of HBV DNA

In 554 out of 918 samples, we performed a qualitative HBV DNA analysis by using an in-house PCR. This allowed us to sequence the samples directly in case of a positive PCR result. We used different primer sets for the amplification due to differences in the primer binding region of different HBV genotypes (P1 = tgctgctatgcctcatcttc, P2 = caragacaaaagaaaattgg, P3 = caaggtatgttgcccgtttgtcc, P4 = ggtawaaagggactcamgatg; primers P1/P2 and P2/P3 and P3/P4 or P1/P4 were combined). A PCR product was sequenced with the amplification primers. Sequence analysis was carried out with the DNA Lasergene SeqMan (GATC Biotech, Konstanz, Germany). We performed pools of 10 samples with 100 μl plasma from each sample and extracted nucleic acids from the complete volume of 1 ml for PCR. The detection limit of the PCR reaction was 150–200 copies/ml with an input volume of 100 μl. A result was called negative, when amplification with neither primer combination was successful.

Definitions

Chronic HBV infection was assumed in cases with detectable HBV DNA and/or HBsAg. In analyses referring to detectable HBV DNA, the term “replicative HBV infection” was used.

HBV genotypic resistance testing

Viral DNA was isolated from 200 μl patient serum using QIAamp DNA Blood Mini-kit (Qiagen, Hilden, Germany). Polymerase chain reaction was performed using HotStarTaq kit (Qiagen, Hilden, Germany) and 3 different primer pairs alternatively described by Allen et al. [19]. PCR products were purified using the QIAquick spin PCR purification kit (Qiagen, Hilden, Germany) and extended using the PCR primers Taq Dye Terminator Ready Reaction Mix, BigDye® version 2.0 (Applied Biosystems, Foster City, CA, USA). Extension products were purified using MultiScreen purification plates (Millipore, Bedford, MA, USA) and Sephadex G-50 superfine (Amersham Biosciences, Upsala, Sweden) and were run on an ABI Prism 3130xl capillary sequencer. The sequences were edited using the DNASTAR Lasergene (GATC GmbH Konstanz, Germany). Sequences were screened for resistance mutations, HBV-genotype and possible escape mutants using Geno2pheno[HBV] and HIV-GRADE-HBV (www.genafor.org, www.HIV-GRADE.de).

HIV genotypic resistance testing

HIV viral load was determined in 912/918 samples. HIV resistance analysis was carried out as described previously [20]. Resistance testing was performed by population-based sequencing detecting mutations in the protease (PR) and reverse transcriptase (RT) of the HIV-1 pol-gene. Only major mutations were scored as resistance-associated according to the current Stanford HIV Drug Resistance Database (accessed November 6, 2009) (available at http://hivdb.standford.edu and according to www.HIV-GRADE.de).

Statistical methods

The statistical analysis was performed using the statistical environment R in version 2.8.1 (www.r-project.org). Wilcox Rank Sum Test was utilized for variable attributes (HIV viral load, CD4 abs./rel., GOT, GPT, GGT and age) to compare the median of independent test samples. Fisher’s Exact Test was applied for categorical attributes. All results are expressed as absolute values and percentages. A 95% confidence interval was chosen to be statistically significant (P = 0.05). For the multivariate analysis, we utilized logistic regression and stepwise forward feature selection. The ROCR package determined the AUC (area under the receiver operating characteristic). The model selection was done with the help of the Akaike Information Criterion (AIC) together with tenfold cross validation to assess the quality of a model. To curb overtraining, the datasets were split into an 80% training set and a 20% test set. The feature and model selection was done on the training set, while the final performance evaluation in terms of AUC was done on the test set. Finally, to compute the impact of the risk factors, we used the complete datasets.

Results

Patient characteristics

In this cohort, the median age of the patients was 37 years (min: 17, max: 77), with a percentage of 75.2% (690/918) men. Ethnical origins were 77.7% (713) Caucasian, 17.1% (157) African black, 3.5% (32) Asian, 1.0% (9) Latin-American, and 0.8% (7) unknown. The most frequent mode of transmission was men who have sex with men (MSM) (47.1%, 432) followed by heterosexual transmission (23.1%, 212), origin from endemic country (17.0%, 156), intravenous drug abuse (IVDA) (7.1%, 65), blood transfusion (0.7%, 6), occupational exposure (0.2%, 2), perinatal transmission 0.1%, 1), and unknown exposure (4.8%, 44).

Seromarkers for HBV and HCV

In 57.5% (520/918) of the patients, no serological signs of HBV infection (anti-HBc and HBsAg neg) were detected, while 43.4% (398/918) of the patients showed indicative seromarkers of present or past HBV infection (i.e. HBsAg and/or anti-HBc). Isolated anti-HBs was detected in 11.5% (97/842) of the patients. These patients with isolated anti-HBs were regarded as immunized against HBV, although a detailed history of immunization was not available and seroconversion after HBV infection could not be ruled out. HBsAg was found in 4.5% (41/918), and anti-HBs was detected in 43.2% (364/842) of the patients. Anti-HBc was identified in 42.8% (393/918); of these, 21.8% (86/393) showed only isolated anti-HBc without any other marker, corresponding to 10.2% of all patients (86/842). Anti-HBc was detected in significantly higher frequencies in patients showing HBV DNA (P < 0.001) (Table 2). HBV DNA was detected in 6.14% (34/554) of the patients. Eighteen out of 34 patients with detectable HBV DNA levels were HBsAg positive. Out of the 34 patients with detectable HBV DNA, 16 patients were HBsAg negative, revealing a frequency of OHBV infection of 2.9% (16/554) (Table 1). Of the 16 identified OHBV patients (i.e. HBsAg negative but detectable HBV DNA), three were isolated anti-HBc positive, 2 were isolated anti-HBs positive and both antibodies were detected in 7 patients. In 4 cases, OHBV was associated with a completely negative HBV serology (HBV viral load was low in all 4 OHBV samples, as judged by the intensity of the bands in our in-house PCR and all samples were double checked for exclusion of contamination). Nevertheless, no significant correlation between OHBV infection and possible risk factors or serological markers could be identified.
Table 1

Prevalence of occult HBV (OHBV) and HBsAg in 554 HIV-positive patients with analysis of HBV DNA

 

HBV DNA negative

HBV DNA positive

Anti-HBC+

Anti-HBS+

Anti-HBC+

Anti-HBS−

Anti-HBC−

Anti-HBS+

Anti-HBC−

Anti-HBS−

Total (n)

520

34

    

OHBV (n)

16

7

3

2

4

 %

2.9 (16/554)

4.3 (7/164)

6.4 (3/47)

3.8 (2/53)

1.9 (4/213)

HBsAg pos. (n)

 

18

 

15

 

3

 %

 

3.2 (18/554)

 

2.7 (15/554)

 

0.5 (3/554)

HBsAg pos. (n)

6

  

6

  

 %

1.1 (6/554)

  

1.1 (6/554)

  

HBsAg pos. (n)

514

 

157

44

51

209

 %

92.8 (514/554)

 

95.7 (157/164)

93.6 (44/47)

96.2 (51/53)

98.1 (209/213)

Table 2

Prevalence, co-morbidities, and univariate analysis of risk factors for replicative HBV in HIV

 

HBV DNA pos. n = 34

HBV DNA neg. n = 520

P value

Median age (range 17–77)

36

37.5

0.472

Male gender %

82.4 (28)

72.5 (377)

0.316

HIV transmission %

 MSM

58.8 (20)

43.8 (228)

0.213

 Heterosexual

20.6 (7)

23.1 (120)

0.685

 Endemic country

14.7 (5)

19.6 (102)

0.511

 IVDA

5.9 (2)

6.5 (34)

1.000

 Other/Unknown

 

6.9 (36)

 

Ethnical origin %

 Caucasian

85.3 (29)

75.4 (392)

0.295

 African/black

11.8 (4)

19.2 (100)

0.367

 Asian

2.9 (1)

3.5 (18)

1.000

 Other/Unknown

 

1.9 (10)

 

HIV viral load (copies/ml)

 Median (range 50–500,000)

39.069

52.350

0.934

 <10,000

18.1% (6)

23.8% (123)

0.532

 10,000–100,000

45.5% (15)

39.7% (205)

0.583

 >100,000

36.4% (12)

36.6% (189)

1.000

CD4 count/mm3

 Median (range 0–1,023)

196

214

0.613

 <200

50.0% (17)

45.8% (238)

0.723

 200–500

35.3% (12)

44.6% (232)

0.373

 >500

14.7% (5)

9.6% (50)

0.368

CD4 count (rel.)

 Median (range 1–56)

16

15

0.742

 <10%

30.3% (10)

29.7% (154)

1.000

 10–20%

39.4% (13)

42.1% (218)

0.856

 >20%

30.3% (10)

28.2% (146)

0.842

CDC-state

 A

47.1% (16)

49.0% (247)

0.861

 B

11.8% (4)

21.8% (110)

0.197

 C

41.2% (14)

29.2% (147)

0.174

Liver parameters

 Median AST (U/l) (range 9–690)

42

32

<0.001

 Median ALT (U/l) (range 6–805)

40

29

0.003

 Median GGT (U/l) (range 5–1,532)

43

36

0.087

 AST > ULN

66.7% (22)

35.2% (181)

<0.001

 ALT > ULN

51.5% (17)

27.7% (141)

0.005

 GGT > ULN

43.8% (14)

32.7% (167)

0.246

HBV serology

 HBsAg

52.9% (18/34)

1.2% (6/520)

<0.0001

 Isolated Anti-HBs

3.2% (1/31)

10.9% (51/467)

0.234

 Isolated Anti-HBc

9.7% (3/31)

9.4% (44/467)

1.000

 anti-HBc/HΒs neg

12.9% (4/31)

44.8% (209/467)

<0.001

 anti-HBc/HBs pos

22.6% (7/31)

33.6% (157/467)

0.241

 anti-HBc pos total

73.5% (25/34)

41.0% (213/520)

<0.001

HCV serology pos %

12.1 (4/33)

9.1 (47/516)

0.534

Bold values are statistically significant (P < 0.01)

Anti-HCV was found in 10.6% (97/918) of the patients, and in 8.3% (8/97) of these patients, HBsAg and/or HBV DNA were detected indicating an active HBV co-infection. Isolated anti-HBc was associated with a positive HCV status (P = 0.0002).

Prevalence, co-morbidities, and risk factors of replicative HBV in HIV

In a multivariate analysis using a logistic regression model, we analyzed factors associated with isolated anti-HBc-positive serostatus (including HIV viral load, CD4 count, mode of transmission, anti-HCV, AST, ALT, GGT, and ethnicity). Origin from an HIV endemic country increased the likelihood (odds) of isolated anti-HBc by a factor of 4.38. Additionally, a positive anti-HCV status increased the odds of isolated anti-HBc by a factor of 3.70. Table 3 summarizes the results of the obtained prediction model. Using the listed factors yielded an AUC of 0.71 and, therefore, showed intermediate prediction capacity.
Table 3

Identification of risk factors for isolated anti-HBc, results of the regression model

Predictor

Odds ratio

95% Confidence interval

P value

Origin from endemic country

4.38

(2.44, 7.89)

<0.0001

GGT > ULN

1.62

(0.95, 2.76)

0.068

Anti-HCV positive

3.70

(1.85, 7.39)

0.0002

ULN upper limit of normal

The proportion of patients with elevated transaminases was significantly higher in replicative HBV (i.e. DNA-positive) infection when compared to patients without detectable HBV DNA (AST elevation P < 0.001, ALT P = 0.003). As shown in Table 2, a significant correlation was found between elevated AST and ALT levels and DNA-positive vs. DNA-negative patients (P < 0.001 and 0.005).

HCV-positive serostatus, identification of risk factors

In a multivariate analysis using a logistic regression model, we analyzed factors associated with HCV-positive serostatus (including HIV viral load, CD4 count, AST, ALT, GGT, age, mode of transmission and ethnicity). IVDU had the greatest impact on a positive HCV serostatus, increasing the odds by a factor of 191.78. Ninety-two percent (61/66) of the patients with a history of IVDU were HCV positive. Additionally, elevated values for either AST or GGT, non-African ethnicity and low HIV viral load were independent and significant predictors for positive HCV serology. The combination of these five factors is highly discriminative and supports a logistic regression model with an AUC of 0.90 evaluated. Table 4 lists the results of the final regression model.
Table 4

Identification of risk factors for a positive HCV serostatus, results of the regression model

Predictor

Odds ratio

95% Confidence interval

P value

IVDU

191.78

(70.60, 520.98)

<0.0001

HIV viral load < 4 × 105

8.02

(1.52, 42.35)

0.012

AST > ULN

2.47

(1.16, 5.26)

0.016

GGT > ULN

2.43

(1.13, 5.20)

0.020

Non-African ethnicity

2.68

(2.26, 3.18)

0.008

79/918 observations had to be removed due to missing values

IVDU i.v. drug use, ULN upper limit of normal

HBV resistance analysis

We could sequence 30 of the HBV DNA–positive samples and found the following genotypes: 18× A, 7× D, 3× G, 1× C, 1× E. Overall, 19 patients had important HBV mutations and these were all HBV treatment-naïve (Table 5). Mutations conferring drug resistance were found in 5 cases (underlined). HBV drug resistance associated mutations were found in 4 patients with OHBV (4 of 13 = 30.8%) whereas only one of the 17 HBsAg positive patients (5.9%) showed such a mutation (P = 0.138). Three of the 4 OHBV cases with drug resistance mutations were negative for all HBV serological markers.
Table 5

HBV associated mutations found in HIV co-infected patients

No.

Genotype

HBV-polymerase mutations

HBsAg mutations

1

A

L140I

N131K

2

A

N122D, G152GR, K168KR, S219A

L95S, K160EK, V190A, S193L, I195IT, S210R, F220C

3

A

N122H, M129L, V163I, R217L

S167*, S207N, V209L

4

A

R138K, S219A

G130N, S210R

5

A

R138KR, S219A

G130DGNS, S210R

6

A

N131DN, I187L, V191IV, L217R, L229M

Q101H, K122KR, A159V, S167L, V168AV, W182*W, P217LP, F220L

7

A

T128AT, S219A

S210R

8

C

R153QR, S223A, I224V

G145GR, S210N

9

D

F122L, Q130P, N139S

T125M, T131A

10

D

F122V, H126R, L145M

T118V, A128V

11

D

H126R

T118A

12

D

H126R, Y135H, V173L, L180M, M204V, Q215S

L97P, T118A, G130E, E164G, I195M, S204N, S207R

13

D

L115M, H126R

T118V, A128V, I208IT

14

D

S119PST, F122L, Q130P, L132M, I169T, M171V, A211G

L109LQ, T125M, F161L, P203A

15

D

Y135S

L84HL, T127P, Y200CY, Y206F, S207N

16

E

V191IV

S167LS, W182*W, L226*L

17

G

H100HQ, V103IV, D118DN

I92IN

18

G

A166V, S174N, P214LP

19

G

V142T, L180M, M204V, L229F

M133I, Y134H, I195M, C221F

The underlined HBV-polymerase mutations are related to drug selection. HBs-mutations in bold represent escape mutants

* Stop codon

HIV resistance analysis

HIV-associated resistance mutations were found in 8.3% (76/912) of therapy-naïve patients. 46% (35/76) of the patients showed NRTI mutations (M41L, A62V, D67N, T69D, L74V, M184V, L210W, and K219E/Q), 47% (36/76) NNRTI mutations (L100I, K101E, K103N, V106A, V108I, V179D/E, Y181C, G190A, and P225H) and 18% (14/76) PI mutations (L33F, M46I/L, V82A, I84V, and L90M). There was no association between transmitted HIV and HBV resistance associated mutations in co-infected patients. However, the presence of HIV resistance associated mutations was significantly correlated with parameters of active HBV infection: HBsAg (P = 0.042), HBV DNA (P = 0.001), OHBV infection (P = 0.019) and with a positive HCV serostatus (P = 0.028).

Discussion

The high discrepancy of findings among studies demands the regional surveillance of HBV infection and the identification of risk factors for chronification. Our study contributes to the understanding of the epidemiology of HIV-Hepatitis B and C co-infection in Germany.

Prevalence, co-morbidities and risk factors of replicative HBV in HIV

There is evidence that HIV may influence the natural course of HBV infection. HIV positive patients have higher rates of HBV chronification and lower rates of seroconversion to anti-HBs [21, 22]. In the here analyzed cohort of therapy naïve HIV patients, 6.1% also had a replicative HBV infection. Other studies had revealed a worldwide prevalence of chronic HBV in HIV-infected patients of approximately 10% [22]. In analogy to other studies, the proportion of patients with elevated transaminases in our cohort was significantly higher in replicative HBV infection [21, 23].

In our cohort, isolated anti-HBc was found in 10.2% of the patients. Of the 16 OHBV patients, three isolates were anti-HBc positive. Sucupira et al. found isolated anti-HBc in 14% of all OHBV cases [24]. In general, OHBV infection is found in low frequencies in patients with isolated anti-HBc [13, 25]. The presence of anti-HBc alone is more frequent in HIV infected women than men [26], a finding that was confirmed in the present analysis.

It was postulated that the detection of anti-HBc only is a strong indicator for replicative HBV infection [4, 27]. In this study, no difference was found between isolated anti-HBc positive patients and those with other HBV markers. Due to the discrepancy between studies, the role of isolated anti-HBc as a marker for chronic HBV infection in HIV treatment-naive patients remains uncertain. Future studies should consider the fact that HBV viremia may be transient in isolated anti-HBc positive patients and may be undetected in single point analyses [4]. Furthermore, in recent infections the frequency of anti-HBc may be lower and could hereby bias the numbers found in different studies.

OHBV, prevalence and risk factors

Occult infection with HBV is a type of HBV infection defined by the presence of HBV DNA in the serum or liver without detectable HBsAg. The diagnosis of OHBV infection in HIV-infected patients is of high importance due to the subsequent choice of dual active agents against both HBV and HIV. We observed a frequency of 2.9% of OHBV infection, and these patients represented almost half of all active HBV infections (i.e. DNA positive). Great variations in the prevalence of OHBV infections have been shown in several studies: with low levels of 0% in a Spanish cohort (85 patients) [5] up to 37% in a French study (30 patients) [28]. This range of prevalence of OHBV infections could be explained by the observation that viremia in OHBV infection is detectable in a short time frame only. Long-term follow-up with sequential analyses revealed higher numbers of OHBV infection [4, 27] (Table 6). Six studies focussing on OHBV infection in treatment-naive patients could not identify any risk factors for OHBV infection [27, 2933]. In this study, elevated transaminases were associated with chronic HBV infection (HBsAg and HBV DNA positive), but not with OHBV infection. In analogy, other studies could also not detect elevated levels of transaminases in OHBV infection [14, 15, 3335], while ALT and AST were higher in the HBsAg positive patients [14].
Table 6

Current literature of occult HBV (OHBV) infection in HIV-infected patients in alphabetical order

Reference

n

Prevalence of OHBV

Risk factors for OHBV

Method of detection

HIV-treatment status

Araujo-NM 2008, Brazil [34]

43 (anti-HBc+)

6/43 (14%)

HCV seropositivity

Semi-nested and real-time PCR, detection limit 100 c/ml (both)

91% ART

Azadmanesh-K 2008, Iran [29]

22 (anti-HBc+)

3/22 (13.6%)

n.d.

Rotor Gene 3000, Corbett Research, Australia. Detection limit 112 c/ml

Naive (1 exeption)

Filippini-P 2006, Italy [27]

86 (serial follow-up over 6 months)

17/86 (19.8%)

n.d.

Perkin-Elmer 9700, USA, detection limit 100c/ml

Naïve

Gandhi, RT 2003, USA [25]

84

1/84 (1.2%)

n.d.

HBV TMA Assay, Gen-Probe, CA, detection limit 84 c/ml

Mixed

Hofer-M EJCMID 1998, Switzerland [4]

57 (anti-HBc+)

17/57 (29.8%) HBV DNA persistence

51/57 (89.5%) HBV DNA intermittently

None

Nested PCR, detection limit 100 c/ml

n.d.

Laguno-M 2008, Spain [44]

238 (HCV co-infection)

15/238 (6.3%)

None

TaqMan HBV Test, Roche Diagnostics, CA, detection limit 35 c/ml

Mixed

Lo Re III-V 2007, USA [15]

179 (anti-HBc+)

17/179 (10%)

Absence of chronic HCV

HIV-RNA > 1,000 c/ml.

HBV TMA Assay, Gen-Probe, CA, detection limit 15 c/ml

Mixed

Morsica 2009 Italy [45]

   

Semi-nested PCR, detection limit 2.6 c/ml

 

Nunez M 2002, Spain [5]

85

0/85 (0%)

n.d.

HBV Monitor, Roche Diagnostics, Netherlands, detection limit 200 c/ml

Mixed

Nebbia-G JMV 2007, Great Brittain [35]

343 (anti-HBc+)

48/343 (14%)

No anti-HBs

Heterosexual transmission

Afro-Caribbean descent

TaqMan HBV Test, Roche Diagnostics, UK, detection limit 35 c/ml

Mixed

Palacios 2008, Spain [46]

   

Cobas TaqMan, Roche Molecular Systems, USA, detection limit 112 c/ml

 

Piroth L 2002, France [37]

37 (anti-HBc+)

13/37 (35%)

None

See below

Mixed

Piroth-L 2008, France [47]

368 (anti-HBc+)

5/368 (1.4%)

n.d.

Qual. PCR, INSERM U271, France, detection limit 16 c/ml

n.d.

Piroth-L 2008, France [47]

111 (HCV co-infection)

6/111 (5.4%)

anti-HBc+ status, low CD4 or CD8 count, no previous ART

Qual. PCR, INSERM U271, France, detection limit 16 c/ml

Mixed

Pogány-K 2005, Netherlands [30]

93 (anti-HBc+)

(<24 Wo vor ART)

4/93 (4%)

n.d.

Cobas amplicor HBV Monitor 2.0, Roche Diagnostics, detection limit 200 c/ml

Naïve

Quarleri-J 2007, Argentina [48]

72 (anti-HBc+)

4/72 (5.6%)

n.d.

Method: PCR–RFLP, detection limit 200 c/ml

100% ART

Rai-RR 2007, India [31]

58

7/58 (12%)

n.d.

Full Article not available via PubMed

Naïve

Ramia-S 2008, Lebanon [49]

87

25/87 (28.7%)

n.d.

Not indicated

n.d.

Rodriguez-Torres 2007, Multinational [50]

866 HIV/HCV co-infection

0/866 (0%)

n.d.

Cobas amplicor HBV Monitor, Roche Diagnostics, detection limit 200 c/ml

Mixed

Santos-EA 2003, Brazil [23]

115 (anti-HBc+)

17/115 (14.8%)

n.d.

Detection limit 100 c/ml

Mixed

Sheng-WH 2007, Taiwan [32]

633

3/179 (7.3%) (isolated anti-HBc+)

3/65 (4.6%) (no serological markers)

n.d.

LighterCycler instrument, Roche Molecular Biochemicals, detection limit 1,000 c/ml

Naïve

Shire-NJ 2007, USA [14]

909

12/909 (1.3%)

Lower HBV DNA

Lower transaminases

Stratagene Mx3000P Real Time PCR (10-specimen sample pools)

Mixed

Shire-NJ 2004, USA [33]

38 (anti-HBc+)

4/38 (10.5%)

n.d.

Cobas amplicor HBV Monitor, Roche Diagnostics, detection limit 200 c/ml

Naive

Sucupira-MV 2006, Brazil [24]

32 (anti-HBc+)

6/32 (1.9%)

n.d.

7700 SDS System, Applied Bio Systems, detection limit 100 c/ml

Mixed

Taylor-L 2008, USA [51]

549 women

>3%

HCV positivity

Not indicated

n.d.

Torres-Barranda 2006, Mexico [52]

38

7/38 (18.4%)

none

Not indicated

n.d.

Tsui-JI 2007, USA [53]

400 women (anti-HBc+)

2%

CD4 < 200/μl

Cobas amplicor HBV Monitor, Roche Diagnostics, detection limit 200 c/ml

n.d.

Wagner-AA 2004, France [28]

30 (anti-HBc+)

11/30 (37%)

Absence of chronic HCV

Nested PCR, detection limit 350 c/ml

n.d.

OHBV infection was defined as detectable HBV DNA without HBsAg. Sensitivity of the assays used in the different studies varied, and results may therefore have been influenced by the testing method

n.d. not defined

Here, the serological markers of HBV infection in OHBV infection were diverse and no single parameter could be assigned as an indicator for OHBV infection. When comparing our data on OHBV infection with a study in the treatment naïve setting by Filippini and co-workers, we found isolated anti-HBc less frequently (36 vs. 19%), while more of our patients were either both anti-HBc and anti-HBs negative (9 vs. 25%) or both anti-HBc and anti-HBs positive (21 vs. 44%) [27]. This comparison demonstrates the great variability of serological markers in OHBV infection. Furthermore, this study demonstrates that the detection of anti-HBs cannot exclude the possibility of coexisting OHBV infection. Therefore, due to a significant rate of OHBV infection in HIV positive patients and a lack of risk factors indicating OHBV infection, the determination of serological markers should routinely be accompanied by the analysis of HBV DNA.

HCV-positive serostatus, identification of risk factors

HCV co-infection was found in 10.6% of the patients. 8.3% of them were co-infected with HBV and HCV. Transmission by IVDU, elevated AST, elevated GGT, non-African ethnicity, and a low HIV viral load were independently associated with HCV positive serostatus. Furthermore, a high correlation between isolated anti-HBc and HCV-positive serostatus was detected, while isolated anti-HBs (indicating past HBV infection) was significantly less frequent in patients with HCV-positive serostatus. Nevertheless, HCV-positive serostatus did not increase the risk for HBV infection. These findings are supported by others [6, 36, 37], but it remains a matter of debate as to what extent HCV co-infection influences the natural course of HIV infection [3, 16, 17, 38]. In our cohort, HCV-positive serostatus was independently associated with a lower HIV viral load. In support of our findings, a slower disease progression was found in HCV co-infection in two other recent studies [39, 40]. In contrast, a better immune status and improved CD4 cell recovery was detected in HCV-negative patients in Switzerland [38]. Discrepant results have been published with regard to the association between OHBV infection and HCV infection. HCV may influence HBV-infection, leading to undetectable HBsAg and promoting OHBV infection [6, 34]. In contrast, Lo and co-workers found an association between the absence of chronic HCV and OHBV infection [15]. In this study, no correlation between HCV-status and OHBV infection could be identified.

HBV resistance analysis

HBV-polymerase mutations related to drug resistance were found in 5/30 cases (16.7%) (Table 5, underlined). Transmitted HBV drug resistance thus constitutes a relevant problem in patients with active HIV–HBV co-infection. Four out of five HBV-associated drug resistance mutations were found in patients with OHBV and in three cases no seromarkers were found, either pointing at a recent infection or indicating a possible influence of these mutations on the expression of HBV seromarkers.

HBV genotypes A and D were most prevalent, and a similar distribution of genotypes was found in a Spanish cohort [41]. HBV genotype A is known to prevail in central and northern Europe and North America, while HBV genotype D is spread worldwide with focuses on the Mediterranean region and the Middle East [42]. Higher response rates to interferon alpha were found for HBV genotype A when compared to genotype HBV-D [43].

HIV resistance analysis

HIV-associated resistance mutations were found in 8.3% of ART naïve patients with a predominance of NRTI (46%) and NNRTI (47%) mutations compared to PIs (18%). HIV resistance mutations were significantly correlated with all markers of active HBV infection (HBsAg (P = 0.042), HBV DNA (P = 0.001) and OHBV infection (P = 0.019)) as well as a positive HCV status. In HBV or HCV co-infected patients, all HIV mutations were NRTI or NNRTI associated.

There are some limitations to this study: the number of active HCV infections was not assessed as HCV RNA was not determined. Furthermore, a qualitative HBV DNA analysis was performed and no quantitative determination of HBV DNA content. Therefore, correlations between the amount of HBV particles and different forms of active infection (OHBV or active HBV infection) could not be performed. HBeAg and anti-HBe results are not available. As a future task follow-up analyses for patients with OHBV will be performed.

Conclusions

Both HBV and HCV infection are frequent in HIV-infected patients. Furthermore, the chronification of HBV occurs at a relatively high rate. It is therefore advisable to test all patients for possible co-infections before initiating HIV treatment. Elevated AST and ALT levels could here give hint for replicative HBV infection, whereas the detection of isolated anti-HBc might be an indicator for severe immune dysfunction.

In comparison with other study cohorts, the rate of HBV DNA–positive infections was relatively low, while OHBV constituted almost half of these HBV DNA–positive infections. Due to a lack of risk factors indicating OHBV, the determination of serological markers should routinely be accompanied by analysis of HBV DNA.

Risk factors found to be independently associated with HCV-positive serostatus included HIV transmission by IVDU, elevated values for AST or GGT, non-African ethnicity and a low HIV viral load.

HIV resistance mutations were significantly correlated with active HBV infection and with a positive HCV status.

Acknowledgments

The RESINA study is supported by a grant from the German Ministry of Health and Social Security (grant no. AZ 319-4476-02/3). We are indebted to Professor W. H. Gerlich for fruitful discussion and critical reading of the manuscript. We would like to thank Eugen Schülter, Claudia Müller and Angelika Hergesell for valuable help in data acquisition.

Copyright information

© Springer-Verlag 2010