Development Genes and Evolution

, Volume 215, Issue 4, pp 207–212

Allelic expression of IGF2 in live-bearing, matrotrophic fishes

Authors

  • Betty R. Lawton
    • Department of Molecular and Cell BiologyUniversity of Connecticut
  • Leila Sevigny
    • Department of Molecular and Cell BiologyUniversity of Connecticut
  • Craig Obergfell
    • Department of Molecular and Cell BiologyUniversity of Connecticut
  • David Reznick
    • Department of BiologyUniversity of California
  • Rachel J. O’Neill
    • Department of Molecular and Cell BiologyUniversity of Connecticut
    • Department of Molecular and Cell BiologyUniversity of Connecticut
Short Communication

DOI: 10.1007/s00427-004-0463-8

Cite this article as:
Lawton, B.R., Sevigny, L., Obergfell, C. et al. Dev Genes Evol (2005) 215: 207. doi:10.1007/s00427-004-0463-8

Abstract

The parental conflict, or kinship, theory of genomic imprinting predicts that parent-specific gene expression may evolve in species in which parental investment in developing offspring is unequal. This theory explains many aspects of parent-of-origin transcriptional silencing of embryonic growth regulatory genes in mammals, but it has not been tested in any other live-bearing, placental animals. A major embryonic growth promoting gene with conserved function in all vertebrates is insulin-like growth factor 2 (IGF2). This gene is imprinted in both eutherians and marsupials, as are several genes that modulate IGF2 activity. We have tested for parent-of-origin influences on developmental expression of IGF2 in two poeciliid fish species, Heterandria formosa and Poeciliopsis prolifica, that have evolved placentation independently. We found IGF2 to be expressed bi-allelically throughout embryonic development in both species.

Keywords

Genomic imprintingPlacentationGenetic conflictInsulin-like growth factor 2Poeciliidae

Introduction

Approximately 75 genes have been identified that show imprinted (i.e. mono-allelic) expression in mammals (Morison et al. 2001). The term imprinting describes several different parent-of-origin effects seen in a wide variety of eukaryotes: from influences on patterns of gene expression to segregation of entire chromosome complements. A strong correlation exists between the presence of imprinting and genetic antagonism, whether host-parasite/pathogen, intersexual or intergenerational in nature (Haig 2000). Genomic imprinting in mammals is widely held to have evolved from genetic conflict between parental genomes over maternal resource allocation to developing offspring (Haig 1992; Wilkins and Haig 2003). The paternal genome in mammals has the opportunity, in utero, to influence the levels and nature of maternal provisioning. The transcriptional silencing of maternal alleles of growth enhancing genes and the transcriptional silencing of paternal alleles of growth suppressing genes is thought to be a consequence of the opposing selection regimes operating in the germ lines of the two sexes.

Unfortunately, very little comparative evidence has been gathered to address this theory, known as the parent-offspring conflict model or, more recently, as the kinship theory (Haig 2000). Imprinted gene expression has been demonstrated in about six eutherian mammals (Morison et al. 2001). Imprinting has also been confirmed in marsupials, which exhibit extensive maternal provisioning (matrotrophy) of gestating young through a hemochorial placenta. Both insulin-like growth factor 2 (IGF2) and IGF2R have been found to be imprinted in marsupials in the same pattern as exhibited by eutherian mammals (Killian et al. 2000; O’Neill et al. 2000). Conversely, IGF2 was found to be bi-allelically expressed in birds (O’Neill et al. 2000). Allele-specific expression assays of IGF2 in egg-laying mammals (monotremata) show it to be bi-allelically expressed in adults, but embryonic expression has not yet been addressed (Killian et al. 2001).

A strong test for the conflict model would be to examine the allelic basis of developmental gene expression in a model organism that has evolved viviparity and matrotrophy independent of mammals. The Poeciliidae constitute a large family of ray-finned fishes, wherein most species give live birth (Rosen and Bailey 1963). Furthermore, placentation has evolved independently, and relatively recently (< 1 million years ago in some clades), in several different lineages of poeciliids (Reznick et al. 2002). These fish offer a unique evolutionary window in which to examine what effects parent-offspring intragenomic conflict may have on developmental gene expression.

The imprinted expression of IGF2, and imprinting of several genes affecting the activity of IGF2, suggests that this gene is at the crux of gestational intragenomic conflict in metatherians (Tilghman 1999). Results are reported here examining the developmental- and allele-specific expression profile of IGF2 in two matrotrophic poeciliid species, Poeciliopsis prolifica and Heterandria formosa. These two species are members of different genera and both have near relatives that lack placentation. In addition to placentation, both species exhibit superfetation, the simultaneous gestation of multiple broods.

Materials and methods

Animals and tissues

H. formosa were derived from the Wacissa River and Trout Pond, both in the vicinity of Talahassee, Florida. Laboratory stocks were established with at least 15 wild-caught adult females and 15 males from each site. P. prolifica were obtained from a long-term laboratory line, originating in the Rio Mayo in the state of Sonora, that had been maintained by Jack Schultz (University of Connecticut, USA), and from wild-caught adults from the vicinity of La Huerta, Mexico, in the Rio Mocorito drainage. Replicate, reciprocal crosses were performed for both species. Because these fish have superfetation, each female provided up to five broods of young in different stages of development. Embryos were staged according to Haynes (1995). Maternal, paternal and embryo tissues were collected and snap-frozen in liquid nitrogen. Genomic DNA for genotyping was extracted from tail fin according to standard methods. RNA was extracted from whole embryos with Trizol (Invitrogen, USA) according to manufacturers instructions.

RT-PCR

Reverse transcription was performed with Invitrogen’s Cloned AMV First Strand Synthesis Kit using 100 ng to 1 μg total RNA from tissue samples, incubated at room temperature for 10 min, 1 h at 42°C, 5 mins at 85°C. For PCR the initial denature step was 94°C for 3 min followed by amplification (94°C 30 s, 50°C 30 s, 72°C 30 s) for 35 cycles. In each reaction 100 ng of each primer were used. Full length IGF2 cDNA sequences for H. formosa (accession AY833403) and P. prolifica (accession AY833402) are in GenBank. H. formosa IGF2: forward TAGCTGTGACCTCAACCTGCT; reverse TCAGTTGTCTTCCACCAGGAT. P. prolifica IGF2: forward TTGTAGAGGAGTGTTGTTTCC; reverse TCACCCTCATACTCTTGTCTGTGC.

Quantitative real-time PCR

Real-time (RT) PCR was performed using the Bio-Rad iCycler and Bio-Rad iQ SYBR Green Supermix. Reverse transcription was performed as in RT-PCR, with 1/40 of RT reaction used in PCR. A melt curve with 80 repeats (55–95°C, +0.5°C−1min) was generated to check for the presence of primer dimers.

Developmental time courses

Amplification conditions: initial denaturation step of 3 min at 95°C, then 35 cycles of 95°C, 60°C, and 72°C for 30 s each. H. formosa and P. prolifica IGF2: primers same as for RT-PCR. β -actin: forward ATGTGCAAAGCCGGATTCGCT; reverse CTCCATGTCATCCCAGTTGG. Sample values and normalization were determined using the relative expression ratio mathematical model (Pfaffl 2001). Briefly, Ct values are transformed according to the equation:
$${\text{Ratio}} = \frac{{E_{{\text{target}}}^{\Delta C{\text{t}}({\text{control - sample}})} }}{{E_{{\text{reference}}}^{C{\text{t}}({\text{control - sample}})} }},$$
where target is IGF2, reference is β- actin, control is stage 6 embryo and sample corresponds to each subsequent stage sample.

P. prolifica allele-specific assay

Amplification conditions: initial denaturation step (3 min 95°C); followed by 35 cycles (30 s 95°C, 30 s 60°C, 30 s 72°C) using 50 ng each of forward and reverse primers. P. prolifica IGF2: common forward primer GCGAAGACAGAGGCTTCTATTTCAG; Mocorito reverse GGGAAACTTCACGGTCACATGT; Mayo reverse GGAAACTTCACATGCGGCTT. β -actin: same as above.

Results and discussion

Placentation in two Poeciliidae

Ovarian and embryonic structures comprising the follicular placenta in P. prolifica and H. formosa are shown in Fig. 1. The ovarian follicle wall becomes fibrous and vascularized (Fig. 1c) and the inner surface becomes involuted with branched microvilli. The embryonic component is comprised of the coelom, yolk sac and a hypertrophied pericardial sac, all covered by a vascular network, the portal system, fed with blood emanating from venous branches of the liver and intestine and culminating in the sinus venosus (Fig. 1b, d). A measure of the amount of maternal provisioning, the matrotrophy index (MI), can be obtained by calculating the ratio of dry mass at birth to dry mass at fertilization. The MI for P. prolifica ranges from 5 to 12, while that for H. formosa ranges from 30 to 40, placing these species among the highest matrotrophic poeciliids (Reznick et al. 2002).
Fig. 1

Placentation and superfetation in Poeciliopsis prolifica and Heterandria formosa. Stereomicrographs of: aP. prolifica gravid ovary; bP. prolifica isolated stage-9 embryo; cH. formosa gravid ovary; dH. formosa isolated stage-9 embryo. FOL Follicle (embryo removed), HT heart tube, L liver, MO mature ovum, OA ovarian artery, PS portal system, SV sinus venosus, ST6, 9, 11 stages 6, 9 and 11 embryos; bar =1 mm

Expression time course for IGF2 in poeciliid development

To confirm IGF2 transcription during embryonic development of H. formosa and P. prolifica we performed an expression time course by quantitative real-time RT-PCR (QPCR). The gestational period for both H. formosa and P. prolifica is approximately 30 days when reared at 25–27°C. The QPCR indicates that IGF2 expression in H. formosa is up-regulated, relative to stable β-actin levels, from minimally detectable levels at stage 6 (discernable optic cup), peaking at stage 9 (approximately 1 week prior to birth) and dropping again to low levels by birth (Fig. 2a). IGF2 is regulated in a similar manner in P. prolifica embryos except that IGF2 transcript levels are maintained at relatively high levels throughout the birth stage (Fig. 2b). In our unpublished observations, however, IGF2 transcripts were undetectable immediately after birth in P. prolifica neonates.
Fig. 2

Quantitative real-time RT-PCR (QPCR) developmental time course of IGF2 expression in Heterandria formosa and Poeciliopsis prolifica embryos. aIGF2 expression in H. formosa is shown in relation to the stage-6 sample whose Ct value is scaled to an arbitrary value of 1, and β-actin is scaled down by a factor of 0.0547. bIGF2 expression in P. prolifca is shown in relation to the stage-6 sample, also set to an arbitrary value of 1, and β-actin is scaled down by a factor of 0.0567. The data points represent the mean and standard deviation for three biological replicates in each panel

Allelic expression profile for H. formosa

Examination of IGF2 cDNA sequences from several individuals from two geographically isolated populations (Trout Pond and Wacissa River) of H. formosa revealed the presence of a single nucleotide polymorphism (SNP) segregated between the two populations. Crosses of individuals homozygous for either SNP-type were mated to produce heterozygous offspring in which the parental source of each allele could be assigned. The SNP consists of a length difference in a string of A’s in the 3′-untranslated region of the gene: 8 A’s in the Trout Pond population and 9 A’s in the Wacissa River population (Fig. 3a, b).
Fig. 3

Allele-specific expression assay for IGF2 in a Heterandria formosa embryo. Automated sequencer electrophoregrams are presented for PCR on genomic DNA (to confirm heterozygosity) and RT-PCR on embryonic RNA. Arrows point to double peaks indicative of the presence of both alleles. a Stage 9 embryo from Wacissa River female X Trout Pond male. b Stage 9 embryo from Trout Pond female X Wacissa River male

Because of the single nucleotide length difference between alleles, allele expression assays had to be performed by running RT-PCR products on a sequencing gel. In order to eliminate genomic fragment contamination, RT-PCR products were generated using primers with annealing sites in different exons. IGF2 is expressed equally from both parental alleles in H. formosa embryos (Fig. 3a). Identical results were obtained for the reciprocal cross (Fig. 3b).

Allelic expression profile for P. prolifica

IGF2 gene sequence was gathered from P. prolifica from a genomic clone isolated from a bacteriophage library constructed from DNA of the laboratory stock. Subsequently, exon-specific PCR primers were designed to capture IGF2 genomic sequence from several wild-caught P. prolifica. A sequence polymorphism was identified consisting of a 6-bp insertion/deletion in the 3′-UTR of IGF2 between the lab stock (May) and individuals isolated from the Rio Mocorito (Moc.). The 6-bp in/del between the two populations allowed the design of allele-specific primers for QPCR analysis, an assay that was not possible with the H. formosa samples. We performed QPCR on middle stage P. prolifica embryos and confirmed balanced, bi-allelic expression of IGF2 in these fish (Fig. 4).
Fig. 4

Quantitative real-time RT-PCR (QPCR) allele-specific expression assay for IGF2 in Poeciliopsis prolifica embryos. Graphs show SYBR (Biorad) green fluorescence measured in each extension step of the amplification cycle. A trace is shown for each allele (Rio Mayo vs Rio Mocorito, May. vs Moc.) in the experiment. a Stage 9 embryo from May. female × Moc. male. b Stage 9 embryo from Moc. female × May. male. Solid, horizontal black line represents the threshold fluorescence value for assay quantification (set to 54.2 RFU)

IGF2 expression in Poeciliidae and the kinship theory

At face value, these results do not support the kinship theory of genomic imprinting. Nevertheless, possible explanations for our results include (1) parent-offspring intragenomic conflict does not operate in these fish in spite of their having placentas; (2) IGF2 is immune to the selective influence of parent-offspring conflict in these fish; (3) poeciliids lack the mechanistic rudiments from which imprinting mechanisms may evolve; or (4) other selective pressures override the impetus for evolution of parent-specific expression patterns.

Addressing these arguments in order:
  1. 1.

    The greater the difference in parental investment, the greater the selection for parent-specific expression patterns (Haig 2000). While the increase in dry mass of fertilized egg to live-born offspring is not as dramatic in these fish as it is in mammals, live-birth and matrotrophy in these fish represent an enormous dedication of maternal resources during a time when both maternal and paternal genomes are active in developing embryos. Superfetation in these species equates to mature females being almost continually pregnant and young are born in broods of as many as six individuals at intervals as short as every few days. The resource allocation and reproductive output collectively of female P. prolifica and H. formosa likely far exceeds that of most mammals. Furthermore, modeling has shown that conflict is most acute in instances of multiple paternity, which is the rule in these live-bearing fish (Soucy and Travis 2003).

     
  2. 2.

    Developmental and physiological studies of IGF2 action in several fish species have established the important role of this hormone in promoting growth during embryogenesis and throughout the life of teleost fishes (Greene and Chen 1997; Radaelli et al. 2003; Reinecke and Collet 1998). Taken in conjunction with the high level conservation of IGF2 amino acid sequence among vertebrates, these observations argue for a conserved role for this gene in development. Nevertheless, it is possible that the IGF2 transcription unit in these fish lacks elements that would be responsive to conflict or that are necessary for establishing gametic marks.

     
  3. 3.

    The key feature of the gametic marks associated with imprinting in mammals is parent-specific patterns of DNA methylation. Parent-specific methylation of CpG islands in regulatory regions associated with imprinted genes is achieved during germline development and gametogenesis by the action of specific DNA methyltransferases (Kaneda et al. 2004). Interestingly, Martin and McGowan (1995) showed parent-of-origin specific marking of transgenes in zebrafish by methylation of CpG dinucleotides within the incorporated transgenes, suggesting that at least some species of fish are capable of gametic marking of DNA.

     
  4. 4.

    Haig argued that a lack of imprinting in organisms harboring parent-offspring conflict may be explained by strong natural selection that overrides selection for imprinted gene expression. Several species and species complexes in the Poeciliidae exhibit clonal and hemiclonal reproduction including parthenogenesis and hybridogenesis. These unusual reproductive strategies are thought to have evolved in response to aspects of the harsh environments in which these fish live and to pressures from parasitism (Vrijenhoek 1993). The inimical relationship of imprinting to clonal reproduction in mammals is well documented (Jaenisch and Wilmut 2001). In poeciliids, perhaps, the selective forces compelling clonal reproduction outweigh the selective forces brought to bear by parental conflict.

     

Acknowledgements

This work was supported by a grant from the National Science Foundation (#MCB-0110930) to M.J.O. and R.J.O.

Copyright information

© Springer-Verlag 2005