Archives of Gynecology and Obstetrics

, Volume 282, Issue 6, pp 677–683

Reduction of hypoxia-induced angiogenesis in ovarian cancer cells by inhibition of HIF-1 alpha gene expression

Authors

    • Division of Gynecologic Oncology, Barbara Ann Karmanos Cancer InstituteWayne State University
  • Adnan R. Munkarah
    • Division of Gynecologic OncologyHenry Ford Health System
  • Sanjeev Kumar
    • Division of Gynecologic Oncology, Barbara Ann Karmanos Cancer InstituteWayne State University
  • Ramesh B. Batchu
    • Department of Surgery, Barbara Ann Karmanos Cancer InstituteWayne State University
  • Jay P. Shah
    • Division of Gynecologic Oncology, Barbara Ann Karmanos Cancer InstituteWayne State University
  • Jeremy Berman
    • Division of Gynecologic Oncology, Barbara Ann Karmanos Cancer InstituteWayne State University
  • Robert T. Morris
    • Division of Gynecologic Oncology, Barbara Ann Karmanos Cancer InstituteWayne State University
  • Zhong L. Jiang
    • Department of Obstetrics and GynecologyWayne State University
  • Ghassan M. Saed
    • Department of Obstetrics and GynecologyWayne State University
Gynecologic Oncology

DOI: 10.1007/s00404-010-1381-9

Cite this article as:
Bryant, C.S., Munkarah, A.R., Kumar, S. et al. Arch Gynecol Obstet (2010) 282: 677. doi:10.1007/s00404-010-1381-9

Abstract

Purpose

The goal of this study was to investigate the effects of silencing HIF-1 alpha gene expression with specific small interfering RNA (siRNA) on VEGF production and angiogenesis in epithelial ovarian cancer (EOC) cells.

Methods

Two EOC cell lines, MDAH-2774 and SKOV-3, were cultured under normoxic (20% O2) and hypoxic (2% O2) conditions using standard techniques. After EOC cells were transfected with siRNA, HIF-1 alpha and VEGF mRNA levels were measured by real-time RT–PCR. Angiogenesis was evaluated utilizing an in vitro assay model consisting of human umbilical vein endothelial cells (HUVEC) and polymerized ECM Matrix.

Results

Both EOC cell lines evaluated constitutively expressed HIF-1 alpha and VEGF mRNA. HIF-1 alpha and VEGF mRNA levels were significantly increased in response to hypoxia (P < 0.05). Under hypoxic conditions, inhibition of HIF-1 alpha gene expression by a specific siRNA resulted in a significant reduction in HIF-1 alpha and VEGF mRNA levels (P < 0.05). In the in vitro angiogenesis model, supernatant from the hypoxic EOC cells induced the HUVEC to form a complex tubular network, a hallmark of angiogenesis. Semi-quantitative analysis of the angiogenesis assay revealed a significant reduction in tube formation when supernatant from HIF-1 alpha siRNA-treated hypoxic EOC cell was used (P < 0.05).

Conclusion

Inhibition of HIF-1 alpha expression by specific siRNA resulted in a significant decrease in VEGF production and angiogenesis. Further investigation of HIF-1 alpha inhibition for anti-tumor activity is warranted and may potentially prove HIF-1 alpha as a therapeutic target in the management ovarian cancer.

Keywords

Ovarian cancerAngiogenesissiRNAGene silencingHIF-1 alphaVEGF

Introduction

Angiogenesis is the development of new blood vessels from the preexisting vasculature. This process is a key factor in the progression of cancer and has been demonstrated to strongly correlate with risk of invasion and metastasis [1, 2]. Vascular endothelial growth factor (VEGF) is a potent pro-angiogenic factor that promotes neovascularization [1]. Elevated expression of VEGF has been reported in ovarian cancer and is associated with a poor prognosis [3].

The balance of pro- and anti-angiogenic factors governs angiogenesis. During tumorigenesis, tumor progression, and metastasis, there is a disruption in the net balance of angiogenic factors, favoring angiogenesis [4]. Hypoxia is believed to be a key signal for activation of the ‘angiogenic switch’ and the resultant increase in expression of VEGF [5, 6]. Hypoxia-induced VEGF expression is regulated by multiple mechanisms, one of which is transcriptional activation [7].

Hypoxia-inducible factor 1 (HIF-1) is a heterodimeric transcription factor composed of a constitutively-expressed HIF-1 beta subunit and an inducibly-expressed HIF-1 alpha subunit [8]. In response to hypoxia, HIF-1 alpha protein accumulates in the cytosol and translocates to the nucleus, where it activates hypoxia-sensitive genes, such as VEGF, by binding to their promoter regions [8, 9]. We have previously shown, when epithelial ovarian cancer (EOC) cell lines MDAH-2774 and SkOV-3 were cultured under hypoxic conditions, a significant increase in the expression of HIF-1 alpha and VEGF mRNA occurs [10].

The goal of this study was to investigate the effect of silencing HIF-1 alpha gene expression with specific small interfering RNA (siRNA) on VEGF mRNA production and angiogenesis of ovarian cancer cells.

Methods

Cell line and cell culture

The human EOC cell lines, MDAH-2774 and SkOV-3, were obtained from American Type Culture Collection (ATCC) (Manassas, VA). Cell lines were cultured in 100 × 20 mm cell culture dish (Corning Inc., NY) with McCoy’s 5A medium (Invitrogen, CA) supplemented with 10% fetal bovine serum (FBS), 100 U of penicillin, 0.1 μg of streptomycin (ATCC). Cells were maintained at confluency at 37°C incubation with 5% carbon dioxide. Culture medium was replaced every 2 days. Culture medium for hypoxic conditions was preequilibrated to the experimental oxygen conditions overnight. For each experiment, cells were plated in 24-well culture dish (Corning Inc., NY) at a cell density of approximately 4.5 × 104 cells per well and cultured for 24 h under normoxic (20% O2, 5% CO2, and 75% N2) or hypoxic conditions (2% O2, 2% CO2, balanced of nitrogen) provided by a gas mixture tank (Wilson Medical Gases Inc., MI).

HIF-1 alpha siRNA design and transfection

siRNAs were designed after determination of target sequences by aligning target (HIF-1 alpha) sequence to an Ambion® web-based algorithm (Ambion, TX). The 21-nucleotide duplex siRNA molecules with 3-dTdT overhangs were resuspended in nuclease-free water according to the instructions of the manufacturer (Ambion, TX). To ensure stringent controls, both a 2A-based mutated control with two nucleotide mismatches (siRNA-2Amut) and a scrambled control sequence (siRNA-SCR) obtained from Ambion® (Silencer Negative Control No.1 siRNA, Ambion, TX, catalog No. 4610) were used. After optimizing transfection condition according to the manufacturer (Ambion, TX), the reverse transfection-, or neofection method was performed, in which cells are transfected as they adhere to the plate after trypsinization. siRNA transfection procedure in the cell lines was performed in accordance with our previously reported works [11]. For siRNA transfection, cells were transferred to a 24-well cell culture plate (Corning Inc., NY) at a concentration of 4.5 × 104 cells per well (cell volume of 450 μL) and transfected with the use of 1.5 μL siPORT™ NeoFX™ reagent and 1 μL of 20 μM siRNA (Silencer™ siRNA Transfection II Kit, Ambion, TX, catalog No. 1631), and 25 μL OptiMEM® medium (Invitrogen, CA, catalog No. 31985–047), up to a final volume of 500 μL. NeoFX™ reagent and siRNA were incubated at room temperature for 10 min and then applied onto 4.5 × 104 cell per well. Transfection mixtures were incubated with cells for 8 h before washing with media and incubated for additional time period to equal total incubation time of 24 h.

Angiogenesis assay

The supernatants of treated and untreated cells were collected and used to evaluate angiogenesis using Chemicon® in vitro angiogenesis assay kit (Chemicon International, CA, catalog No. ECM625). The assay, which utilized human umbilical vein endothelial cell (HUVEC), was performed as follows: the ECMatrix™ solution was thawed at 4°C overnight. Hundred microliters of 10× ECMatrix™ Diluent Buffer was added to 900 μL of ECMatrix™ solution in a sterile microfuge tube. Fifty microliters of this mixture was transferred to each well of a pre-cooled 96-well tissue culture plate and incubated at 37°C for at least 1 h to allow the matrix solution to solidify. Endothelial cells were harvested and resuspended in either endothelial cell growth media or the supernatant retrieved from control or treated ovarian cancer cells. Cells were seeded at a density of 1.0 × 106 cells per well onto the surface of the polymerized ECMatrix™ and incubated at 37°C for 12 h. Cellular network structures are fully developed by 12–18 h, with the first signs apparent after 4–6 h. Tube formation was detected using an inverted light microscope at 40×–200× magnification. Semi-quantitative analysis of the angiogenesis assay was performed by defined visual pattern recognition/value association criterion (Table 1).
Table 1

Semi-quantitative analysis of angiogenesis

Pattern

Value

Individual cells, well separated

0

Cells begin to migrate and align themselves

1

Capillary tubes visible, no sprouting

2

Sprouting of new capillary tubes visible

3

Closed polygons begin to form

4

Complex mesh like structures develop

5

Measurement of HIF-1 alpha and VEGF mRNA levels by real-time reverse transcriptase polymerase chain reaction

Total RNA was isolated from human EOC cells with the use of the monophasic solution of phenol and GITC/Trizol method as we have previously described [12, 13].

Preparation of complimentary DNA (cDNA): using the QuantiTect® reverse transcription (RT) kit (Qiagen, CA, catalog No. 205311), the genomic DNA elimination reaction was prepared on ice, 2 μL of gDNA wipeout buffer, 1 μg of template RNA, and 2 μL of RNase-free water was incubated at 42°C for 2 min. The RT reaction components were prepared by adding 1 μL of Quantiscript® reverse transcriptase, 4 μL of Quantiscript® RT Buffer, and 1 μL of RT primer mix to the genomic DNA elimination reaction mixture and were incubated for 15 min at 42°C. The Quantiscript® reverse transcriptase mixture was then incubated for 3 min at 95°C to inactivate the enzyme.

Quantitative PCR analysis was performed using a QuantiTect™ SYBR® Green PCR kit (Qiagen, CA catalog No. 204143) and a SmartCycler® 1.2f Detection System (Cepheid, CA). Real-time polymerase chain reaction (PCR) was performed in a 25-μL total reaction volume including 12.5 μL of 2× QuantiTect™ SYBR® Green PCR Master Mix, 1 μL of cDNA template, and 0.3 μM each of target-specific primers designed to amplify a part of each gene. To quantify each target transcript, a standard curve was constructed with serial dilutions of β-actin plasmid (Invitrogen, CA). After PCR, a melting curve analysis was performed to demonstrate the specificity of the PCR product as a single peak. A control, containing all the reaction components except for the template, was included in all experiments. The amount of each mRNA (HIF-1 alpha and VEGF) then was normalized to the housekeeping gene, β-actin. The PCR reaction conditions for each primer were as follows:
  1. 1.

    VEGF: An initial cycle was performed at 95°C for 8 min, followed by 35 cycles of 95°C for 15 s, 55°C for 30 s, 72°C for 30 s, and then a final cycle at 72°C for 7 min to allow completion of product synthesis

     
  2. 2.

    HIF-1 alpha: An initial cycle was performed at 95°C for 15 min, followed by 35 cycles of 95°Cfor 15 s, 56°C for 30 s, 72°C for 30 s, and then a final cycle at 72°C for 7 min to allow completion of product synthesis

     
Primer design and controls: optimal oligonucleotide primer pairs for PCR amplification were selected with the aid of the computer program Oligo 4.0 (National Bioscience, Inc., Plymouth, MN). Sequences of the oligonucleotides used for amplification of HIF-1 alpha, VEGF, and β-actin mRNAs are as we previously reported (Table 2) [10].
Table 2

Oligonucleotide Sequences

Locus

Sense (5′–3′)

Anti-sense (5′–3′)

Base pair

β-actin

AAGCAGGAGTATGACGAGTCCG

GCCTTCATACATCTCAAGTTGG

559

VEGF

GCTGTCTTGGGTGCATTGGA

ATGATTCTGCCCTCCTCCTTCT

100

HIF-1α

CCAGCAGACTCAAATACAAGAACC

TGTATGTGGGTAGGAGATGGAGAT

138

Statistical analysis

Each treatment was performed in three independent experiments. The data are presented as the means ± SD. Student’s t test was conducted using SPSS to evaluate the difference of the means between groups. Pearson’s correlation was used to assess associations between mRNA levels and treatments (v15.0 for Windows, SPSS, IL). Differences were considered to be significant if P < 0.05.

Results

Silencing HIF-1 alpha gene expression by specific siRNA reduced HIF- alpha and VEGF mRNA levels in ovarian cancer cells exposed to hypoxia

Both cell lines in this study constitutively expressed HIF-1 alpha and VEGF mRNA. Treatment with hypoxia resulted in a significant increase in the expression of HIF-1 alpha mRNA levels in the MDAH-2774 (57%; P < 0.05) and SkOV-3 (53%; P < 0.05) cells (Figs. 1, 2). Treatment with hypoxia also resulted in a significant increase in the expression of VEGF mRNA levels in the MDAH-2774 (51%; P < 0.05) and SkOV-3 (93%; P < 0.05) cells (Figs. 1, 2). Treatment of MDAH-2774 cells with HIF-1 alpha siRNA under normoxic conditions resulted in no significant change in either HIF-1 alpha or VEGF mRNA levels (Fig. 1). In contrast, treatment of SkOV-3 with HIF-1 alpha siRNA under normoxic conditions resulted in a significant decrease in HIF-1 alpha mRNA levels (50%; P < 0.05) and no change in VEGF mRNA levels (Fig. 2). Treatment with HIF-1 alpha siRNA under hypoxic conditions resulted in a significant decrease in HIF-1 alpha mRNA levels in the MDAH-2774 (31%; P < 0.05) and SkOV-3 (67%; P < 0.05) cells (Figs. 1, 2). Treatment with HIF-1 alpha siRNA under hypoxic conditions resulted in a significant decrease in VEGF mRNA levels in the MDAH-2774 (26%; P < 0.05) and SkOV-3 (81%; P < 0.05) cells (Figs. 1, 2).
https://static-content.springer.com/image/art%3A10.1007%2Fs00404-010-1381-9/MediaObjects/404_2010_1381_Fig1_HTML.gif
Fig. 1

Real-time PCR mRNA levels of HIF-1a and VEGF in MDAH-2774 EOC cells in response to hypoxia and HIF-1a siRNA treatment. Data collected from three independent experiments are shown as mean ± SD. During hypoxic conditions, treatment of EOC cells with HIF-1a siRNA resulted in significant decrease in HIF-1a and VEGF mRNA levels (P < 0.05)

https://static-content.springer.com/image/art%3A10.1007%2Fs00404-010-1381-9/MediaObjects/404_2010_1381_Fig2_HTML.gif
Fig. 2

Real-time PCR mRNA levels of HIF-1a and VEGF in SkOV-3 cells in response to hypoxia and HIF-1a siRNA treatment. Data collected from three independent experiments are shown as mean ± SD. During hypoxic conditions, treatment of EOC cells with HIF-1a siRNA resulted in significant decrease in HIF-1a and VEGF mRNA levels (P < 0.05)

Correlation between HIF-1 alpha and VEGF mRNA levels

A significant positive correlation was observed between HIF-1 alpha and VEGF mRNA levels in both EOC cell lines when cultured under hypoxic conditions (MDAH-2774 r = 0.971, P = 0.001; SkOV-3 r = 0.974, P = 0.001). There was no correlation noted between HIF-1 alpha and VEGF mRNA levels when cultured under normoxic conditions. There was a significant positive correlation observed between HIF-1 alpha and VEGF mRNA levels when both cell lines were treated with HIF-1 alpha-specific siRNA under hypoxic conditions (MDAH-2774 r = 0.941, P = 0.005; SkOV-3 r = 0.982, P < 0.001).

Silencing HIF-1 alpha gene expression by specific siRNA significantly reduced angiogenesis

When cultured under normoxic conditions, the supernatant from both cell lines resulted in no significant difference in angiogenesis when compared with controls. When cultured under hypoxic conditions, supernatant from both cell lines treated with HIF-1 alpha siRNA resulted in significant decrease in angiogenesis (P < 0.05) (Figs. 3, 4).
https://static-content.springer.com/image/art%3A10.1007%2Fs00404-010-1381-9/MediaObjects/404_2010_1381_Fig3_HTML.jpg
Fig. 3

Angiogenesis assay of MDAH-2774 EOC cell line supernatant during hypoxia. Semi-quantitative analysis revealed significant reduction in angiogenesis (P < 0.05). a Without HIF-1a specific siRNA. b With HIF-1a specific siRNA. Controls are not pictured

https://static-content.springer.com/image/art%3A10.1007%2Fs00404-010-1381-9/MediaObjects/404_2010_1381_Fig4_HTML.jpg
Fig. 4

Angiogenesis assay of SkOV-3 EOC cell line supernatant during hypoxia. Semi-quantitative analysis revealed significant reduction in angiogenesis (P < 0.05). a Without HIF-1a specific siRNA. b With HIF-1a specific siRNA. Controls are not pictured

Discussion

In 1971, Folkman [1] proposed that tumor growth and metastasis are angiogenesis-dependent, and hence blocking angiogenesis could be a strategy to arrest tumor growth. Based on successful preclinical data, several anti-angiogenic agents alone or in combination with conventional therapies are now in clinical trials [4]. Clinical and pre-clinical research have identified the following strategies for targeting angiogenesis: (1) interference with angiogenic ligands, their receptors or downstream signaling, (2) up-regulation or delivery of endogenous inhibitors, (3) directly targeting the tumor vasculature, or recently (4) the use of RNA interference to silence genes specific for angiogenesis [4, 11, 1416].

Angiogenesis is a critical step in the process of cancer progression. VEGF, one of the most potent angiogenic cytokines, is over expressed in a large number of malignancies, including epithelial ovarian carcinomas [17, 18]. Angiogenesis commonly occurs in response to conditions of low oxygen concentration [18]. We have previously reported a positive correlation between HIF-1 alpha and VEGF mRNA levels after ovarian cancer cells were cultured under hypoxic conditions [10]. We have also previously reported on the pharmacologic inhibition and siRNA gene silencing of alternate angiogenic pathways that resulted in decreased VEGF mRNA levels and angiogenesis [11, 19].

VEGF production is regulated through a number of pathways, one of which is transcriptional activation via HIF-1 alpha. HIF-1 alpha functions as a master regulator of oxygen homeostasis and is commonly overexpressed in human cancers and their metastases [20, 21]. HIF-1 alpha helps to restore oxygen homeostasis by inducing glycolysis, erythropoiesis, and angiogenesis [5, 7].

Carmeliet et al. reported that when embryonic stem (ES) cells with inactivated HIF-1 alpha genes were exposed to hypoxic conditions, the cellular responses included reduced expression of VEGF, impaired formation of large vessels in ES-derived tumors, and impaired vascular function. Their findings suggest that tumor vascularization is largely controlled by HIF-1 alpha, in part as a result of VEGF production [5]. Wang et al., found that HIF-1 alpha protein plays a bimodal role in cellular hypoxic response in cancer cells including opposite effects of hypoxia, simultaneously promoting cell death and activating cellular antiapoptotic resistance. They went onto describe that downregulation of HIF-1 alpha promoted cell death and prevented activation of cellular defenses by hypoxia [22].

According to our previous [10] and current studies, HIF- alpha and VEGF mRNA levels are constitutively expressed in MDAH-2774 and SkOV-3 cells. Treatment with hypoxia was associated with a significant increase in HIF-1 alpha and VEGF mRNA levels. VEGF was not significantly altered by HIF-1 alpha siRNA under normoxic conditions. This can be explained by the regulator mechanism of HIF-alpha activity. A decrease in cellular O2 tension leads to elevation of HIF-1 alpha activity via stabilization of the HIF-1 alpha protein. Conversely, ubiquitin-mediated proteolysis of HIF-1 alpha protein on exposure to normoxic environment results in a rapid decay of HIF-1 alpha activity [23].

Surprisingly, HIF-1a mRNA was not significantly reduced by HIF-1 alpha siRNA in both cell lines when cultured under normoxic conditions. Optimization of the siRNA transfection process resulted in a lesser reduction in HIF-1 alpha mRNA in the MDAH-2774 cells as compared with the SkOV-3 cells. The less-than-expected decrease in HIF- alpha mRNA level in the MDAH-2774 cells might be explained by a less effective transfection process during our experiment or by similar mechanisms reported in the literature describing target-specific and off-target effects of RNA interference [24].

The findings in the current study with regard to hypoxia induction of HIF-1 alpha and VEGF mRNA production and angiogenesis are consistent with previous reports in the literature. Treatment with HIF-1 alpha-specific siRNA resulted in a significant decrease in HIF-1 alpha and VEGF mRNA in both ovarian cancer cell lines when cultured under hypoxic conditions. The in vitro angiogenesis model revealed that treatment of the ovarian cancer cells with HIF-1 alpha-specific siRNA resulted in a significant reduction and inhibition of tube formation by the HUVEC endothelial cells.

In this study, we have confirmed a role of HIF-1 alpha in ovarian cancer angiogenesis with the use of an in vitro model. In addition, current preclinical and clinical data with selective angiogenesis inhibitors are yielding very encouraging results. Further investigation of HIF-1 alpha inhibition for anti-tumor activity is warranted and may potentially prove HIF-1 alpha as a therapeutic target in the management ovarian cancer.

Conflict of interest statement

None.

Copyright information

© Springer-Verlag 2010