Rheumatology International

, Volume 30, Issue 1, pp 69–74

DNase1 exon2 analysis in Tunisian patients with rheumatoid arthritis, systemic lupus erythematosus and Sjögren syndrome and healthy subjects

Authors

  • Salima Belguith-Maalej
    • Unité Cibles pour le Diagnostic et la ThérapieCentre de Biotechnologie de Sfax
    • Unité Cibles pour le Diagnostic et la ThérapieCentre de Biotechnologie de Sfax
  • Neila Kaddour
    • Service de Médecine interne, CHU Hédi-Chaker
  • Zouhir Bahloul
    • Service de Médecine interne, CHU Hédi-Chaker
  • Hammadi Ayadi
    • Unité Cibles pour le Diagnostic et la ThérapieCentre de Biotechnologie de Sfax
Original Article

DOI: 10.1007/s00296-009-0917-4

Cite this article as:
Belguith-Maalej, S., Hadj-Kacem, H., Kaddour, N. et al. Rheumatol Int (2009) 30: 69. doi:10.1007/s00296-009-0917-4

Abstract

Autoimmune diseases (AID) are caused by the loss of immunological tolerance against self-antigens. The deoxyribonuclease I (DNASE1) gene seems to participate in the genetic susceptibility of some AID. In fact, two mutations were reported among systemic lupus erythematosus (SLE) patients from Japan and Spain (the 172 A → T mutation (K5X) and the 46_72 deletion, respectively). The aim of our work was to evaluate the DNASE1 contribution in the genetic susceptibility of rheumatoid arthritis (RA, n = 151), Sjögren syndrome (SS, n = 55) and SLE (n = 34) in Tunisia. DNA from patients and healthy subjects (n = 232) were explored. Both reported mutations were absent among patient and control subjects. The DNASE1 exon2 sequence was analysed among 26 control subjects to identify new polymorphic variations that are possible. Five known SNPs were explored. The G/T transversion (rs8176927: R2S) was the most polymorphic functional nonsynonymous SNP. Using PCR-RFLP method, all DNAs were genotyped for rs8176927 for a case–control design. The statistical analysis showed no significant differences between patients and controls genotype data. In conclusion, our study showed, on the one hand, the absence of the K5X mutation and the 46_72 deletion in Tunisian patients affected with RA, SS and SLE and healthy subjects, and, on the other hand, the absence of association between the R2S polymorphism and the genetic susceptibility of RA, SS and SLE.

Keywords

Autoimmune diseasesDeoxyribonuclease ISystemic lupus erythematosusSjögren syndromeRheumatoid arthritis

List of abbreviations

AID

Autoimmune diseases

ANA

Anti-nuclear antibodies

DNASE1

Deoxyribonuclease 1

ds

Double strand

HETObs

Observed heterozygosity

PCR-RFLP

Polymerase chain reaction-restriction fragment length polymorphism

RA

Rheumatoid arthritis

SLE

Systemic lupus erythematosus

SNP

Single nucleotide polymorphism

SS

Sjögren syndrome

Introduction

Deoxyribonuclease I (DNASE1) is an endonuclease that preferentially attacks double-stranded DNA in a Ca2+-dependent manner to produce oligonucleotides with 5′-phospho and 3′-hydroxy termini [1]. DNASE1 has been shown to be the candidate nuclease that is responsible for internucleosomal DNA degradation during apoptosis [2, 3]. A defect in nucleases (and especially DNASE1 [4]) functioning may lead to the generation of autoimmune diseases (AID) [58]. In this situation, the nucleic acid–protein complexes may persist for abnormally long period, result in prolonged antigenic stimulation and cause more available DNA to bind to target tissues or to circulating anti-DNA auto antibodies [911]. Several studies suggest that DNASE1 may be involved in the pathogenesis of AID [1215]. Already, Yasutomo et al. [16] had identified a mutation in DNASE1 gene in two Japanese female patients diagnosed as having systemic lupus erythematosus (SLE) and Sjögren syndrome-A (SS-A). The mutation corresponds to an A/T transversion in exon2, which resulted in a lysine-to-stop substitution at codon 5. This mutation, present in heterozygotic state, is responsible for decreasing DNASE1 activity in patient’s sera and increasing of IgG titer against nucleosomal antigens. Analysis of the A/T transversion in 1,516 human chromosomes from the UK showed the absence of this mutation in subjects with SLE (n = 182) or Graves’ disease (n = 291) and in healthy controls (n = 285) [17]. The absence of the K5X mutation was also reported by Chakraborty et al. [18] on Tunisian population (39 SLE patients and 91 healthy subjects), Liu et al. [19] on Chinese population (149 patients with SLE and 46 normal subjects) and by Balada et al. [20] on Spanish population (108 SLE patients and 100 healthy control subjects). Recently, three novel DNASE1 mutations related to SLE were discovered in two Spanish patients [21]. A deletion of 36 bp in exon2 (46_72del) was described. It involved the last seven amino acids of the signal peptide and the first five amino acids of the mature protein.

In the present study, we investigate the DNASE1 exon2 sequence for a possible involvement in SLE, RA and SS development using Tunisian sample.

Subjects and methods

Subjects

Two hundred and forty Tunisian unrelated patients affected with AID (34 affected with SLE, 55 affected with SS and 151 affected with RA) and 232 Tunisian healthy subjects with no familial history of autoimmune and inflammatory joint diseases were analysed in this study.

The SLE patients were selected after diagnosis according to the American College of Rheumatology 1982 revised criteria for the classification of SLE [22]. The SS and RA patients were selected based on the Kaplan classification criteria [23] and the American College of Rheumatology criteria [24], respectively. This work was approved by the CHU (Centre Hospitalo-universitaire) Hédi Chaker of Sfax (Tunisia) ethic committee. All the blood samples were collected after obtaining informed consent from patients and healthy subjects.

Genotyping

Genomic DNA from patients and controls was obtained from peripheral blood as previously described [25].

Mutation

The 172 A/T transversion mutation (K5X) was genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using the following primers: K5XF TTAAAACTCCCAGACACGCACTG (forward) and K5XR CTGCACAATGTAGCTGACGAGG (reverse). The PCR product (678 bp) was digested with the restriction enzyme Nsp I (New England Biolabs, Beverly, MA) as previously described [16]. The positive control was performed on a commercial plasmid cloning vector pUC19 containing 3 Nsp1 restriction sites. The exploration of the K5X mutation among SLE patients was already published by Chakraborty et al. [18].

The 46_72 deletion was genotyped by fragment size analyses on 3% agarose gel electrophoresis of PCR products.

Single nucleotide polymorphism

The G/T transversion (R2S: rs8176927) was genotyped using the appropriate primers: R2SF CTGACCTTGAGCTCCACCAG (forward) and R2SR GCCCCCAGCAGCTTCATGGC (reverse). R2S reverse primer was designed to include a potential restriction site to HaeIII restriction enzyme, in the amplified fragment. The PCR was performed in a total volume of 50 μl containing 60 ng of genomic DNA, 200 μM of dNTPs, 0.2 μM of each primer, 1U of Taq DNA polymerase (Fermentas), 2.5 mM of MgCl2 and 1× Taq buffer. Cycling conditions were as follows: initial denaturation at 94°C for 5 min followed by 38 cycles of denaturation at 94°C for 30 s, annealing at 59°C for 30 s and extension at 72°C for 30 s. Final elongation was done at 72°C for 5 min.

The amplified products were digested with the restriction enzyme HaeIII (New England Biolabs) and analyzed on a 3% agarose gel. The G allele corresponds to the presence of two fragments (117 and 20 bp) generated by HaeIII digestion, and the uncleaved fragment reflects the presence of the T allele (Fig. 1). The positive control was performed on a commercial plasmid cloning vector pUC19 containing 11 HaeIII restriction sites.
https://static-content.springer.com/image/art%3A10.1007%2Fs00296-009-0917-4/MediaObjects/296_2009_917_Fig1_HTML.gif
Fig. 1

The rs8176927 polymorphism exploration, electrophoresis analysis and sequence validation: a homozygous individual (GG); b heterozygous individual (GT)

Sequencing

The PCR product (678 bp), containing five SNPs (rs8176921, rs8176922, rs8176927, r8176930 and rs34907394), was sequenced among 26 healthy subjects using an ABI Prism 3100-Avant (Applied Biosystems).

Statistical analysis

The Hardy–Weinberg equilibrium was calculated by “HWE” program v1.1 provided by J. Ott (Utility Programs for Analysis of Genetic Linkage). The alleles and genotype distributions comparison among patients and controls was performed using the χ2 test. Statistical significance was reached when P < 0.05.

Results

The exploration of DNASE1 exon2 sequence among patient and healthy subjects has shown the absence of the K5X mutation and the 46_72 deletion previously described among Japanese and Spanish population, respectively.

The direct sequencing of the PCR product (678 bp) of 26 healthy subjects has shown a weak variability. In fact, five SNP sites (two intronic and three exonic) were covered and the most important observed heterozygosity was found with the rs8176927 SNP (HETObs = 0.115) which substitutes Arg to Ser at the second position of the signal peptide of the protein. Intriguingly, the analysis of the DNASE1 protein sequences among mammalian animals has shown the conservation of the Arg residue (Fig. 2). Change from large size and basic (R) residue to small size and polar (S) residue could have an impact in protein trafficking through cellular organelle and the protein production in the cytoplasmic compartment. This finding has prompted us to explore the R2S polymorphism among patients and healthy subjects for a case–control design.
https://static-content.springer.com/image/art%3A10.1007%2Fs00296-009-0917-4/MediaObjects/296_2009_917_Fig2_HTML.gif
Fig. 2

Alignment of DNASE1 exon2 protein sequences among mammalian animals. *The conservation of Arg (R) residue

The DNA of 240 patients (34 SLE, 55 SS and 151 RA) and 232 controls was explored by PCR-RFLP for an eventual association between G/T transversion (rs8176927) and the emergence of SLE, SS and RA. However, the genotypic and allelic distributions did not show any significant differences between patients and controls data (Table 1).
Table 1

The genotypic and the allelic distribution of Arg2Ser SNP (rs8176927) among patient and control subjects

 

RA (n = 151)a

SS (n = 55)b

SLE (n = 34)c

Total patients (n = 240)d

Controls (n = 232)

N

%

N

%

N

%

N

%

N

%

Genotypes

 GG

135

89.41

53

96.36

32

94.12

220

91.67

211

90.95

 GT

16

10.59

2

3.64

2

5.88

20

8.33

21

9.05

Alleles

 G

286

94.71

108

98.18

66

97.06

460

95.84

443

95.47

 T

16

5.29

2

1.82

2

2.94

20

4.16

21

4.53

The HWE was verified among control genotype data

No differences were found between male and female genotypes distributions

aGenotype χ2 = 0.25, df = 1, P = 0.61; allelic χ2 = 0.24, df = 1, P = 0.62

bGenotype χ2 = 1.77, df = 1, P = 0.18; allelic χ2 = 1.69, df = 1, P = 0.19

cGenotype χ2 = 0.38, df = 1, P = 0.53; allelic χ2 = 0.36, df = 1, P = 0.54

dGenotype χ2 = 0.08, df = 1, P = 0.78; allelic χ2 = 0.07, df = 1, P = 0.78

Discussion

Systemic lupus erythematosus, rheumatoid arthritis and Sjögren syndrome are chronic AID with worldwide distribution. Susceptibility to these diseases is determined by environmental, immunological and genetic factors. Although there are many candidate proteins that are involved in the pathogenesis of these AID, it still remains unclear how immunological tolerance is troubled in each disease.

Systemic lupus erythematosus is typical of systemic AID and is associated with the production of a variety of autoantibodies, including anti-nuclear antibodies (ANA), directed against naked DNA, entire nucleosomes and ribonucleoprotein components of the spliceosome complex [9, 10, 26]. The amount of serum anti-double strand (ds) DNA antibodies is correlated with the clinical evidence of SLE disease activity [11, 27, 28], although the contribution of anti-nucleosomal antibodies to the pathogenesis of SLE remains unknown.

The presence of the anti-nuclear or anti-dsDNA antibodies among SS and RA patient was also described before or after TNF-alpha blocking agent treatment [29, 30]. The association of SLE, RA and SS was well documented in the overlap syndrome in patients having more than one connective tissue diseases at the same time [3133]. These findings suggest that SLE, RA and SS could share some common genetic components.

DNASE1 could be a good functional candidate gene. The alteration of DNASE1 protein activity seems to have no negligible impact in clinical and biological complication and severity of systemic AID.

We recently discovered two DNASE1-deficient SLE patients (heterozygous A/T transversion; K5X) with very high serum titers of anti-dsDNA antibodies [16]. Naiperi et al. [34] has independently reported that DNASE1-deficient mice also developed a SLE-like syndrome [34]. Thereafter, several researcher groups have looked for the 172 A/T transversion in series of SLE and control populations, and not a single instance of this mutation has been found [1720]. In addition, Bodano et al. [21] identified three new mutations among Spanish SLE patients [21]. The 46_72del, the 1760G/A and 1785C/T mutations could contribute to the deficiency in DNASE1 activity. However, it is difficult to explain the auto-antibodies production and the SLE emergence considering only one altered variant. Anyway, the DNASE1 gene contribution in the SLE development could be real, but in the majority of cases, other causes will account for the reduced enzymatic activity, the auto-antibodies production and the SLE complication criteria appearance.

Using Tunisian patients affected with SLE, RA and SS and healthy subjects we failed to find the 172 A/T and the 46_72del mutations. In addition, the case–control study comparing rs8176927 (R2S) genotype and allele distributions among patients versus healthy subjects did not show a significant difference.

The absence of both mutations in our explored sample reflects the absence of a particular rare form of SLE reported by Yasutomo et al. [16] and Bodano et al [21]. However, we cannot exclude the contribution of DNASE1 gene in SLE, RA or SS genetic susceptibility. Indeed, sequence change in or near the DNASE1 gene may alter its expression or the DNASE1 protein interaction with DNA. Therefore, the exploration of DNASE1 genomic sequence (particularly promoter and coding sequences) by direct sequencing could verify this hypothesis; in fact, recently, a causal variant was identified in the DNASE1 exon8 sequence (rs1053874, R244Q) among SLE patients from Korea [35].

The inclusion (or the exclusion) of DNASE1 gene in (or from) the genetic susceptibility of some systemic diseases seems to be useful to distinguish the particular form of the disease from the general common form caused by the interaction of several minor effects genes with the environmental factors.

Conclusion

Our work have shown no particular variant in exon2 sequence of DNASE1 gene among Tunisian patients affected with SLE, RA and SS and Healthy subjects.

Acknowledgments

This work was supported by the Ministère de lenseignement supérieure de la Recherche Scientifique et de la Technologie (Tunisia) and the International Center for Genetic Engineering and Biotechnology (ICGEB) (Italy). We thank LGMH (Laboratoire de Génétique Moléculaire Humaine, faculté de Médecine de Sfax) members for the technical help. We are also very grateful for discussions with Dr. Saber Masmoudi.

Copyright information

© Springer-Verlag 2009