Current Microbiology

, Volume 62, Issue 5, pp 1581–1589

Mycobacterium tuberculosis Expresses ftsE Gene Through Multiple Transcripts

Authors

  • Sougata Roy
    • Indian Institute of ScienceMicrobiology and Cell Biology
    • Cardiovascular Research InstituteUniversity of California San Francisco
  • Srinivasan Vijay
    • Indian Institute of ScienceMicrobiology and Cell Biology
  • Muthu Arumugam
    • Indian Institute of ScienceMicrobiology and Cell Biology
  • Deepak Anand
    • Indian Institute of ScienceMicrobiology and Cell Biology
  • Mushtaq Mir
    • Indian Institute of ScienceMicrobiology and Cell Biology
    • Division of Infectious DiseasesHarvard Medical School, Children’s Hospital
    • Indian Institute of ScienceMicrobiology and Cell Biology
Article

DOI: 10.1007/s00284-011-9897-1

Cite this article as:
Roy, S., Vijay, S., Arumugam, M. et al. Curr Microbiol (2011) 62: 1581. doi:10.1007/s00284-011-9897-1

Abstract

Bacterial FtsE gene codes for the ATP-binding protein, FtsE, which in complex with the transmembrane protein, FtsX, participates in diverse cellular processes. Therefore, regulated expression of FtsE and FtsX might be critical to the human pathogen, Mycobacterium tuberculosis, under stress conditions. Although ftsX gene of M. tuberculosis (MtftsX) is known to be transcribed from a promoter inside the upstream gene, ftsE, the transcriptional status of ftsE gene of M. tuberculosis (MtftsE) remains unknown. Therefore, the authors initiated transcriptional analyses of MtftsE, using total RNA from M. tuberculosis cells that were grown under stress conditions, which the pathogen is exposed to, in granuloma in tuberculosis patients. Primer extension experiments showed the presence of putative transcripts, T1, T2, T3, and T4. T1 originated from the intergenic region between the upstream gene, MRA_3135, and MtftsE. T2 and T3 were found initiated from within MRA_3135. T4 was transcribed from a region upstream of MRA_3135. RT-PCR confirmed co-transcription of MRA_3135 and MtftsE. The cloned putative promoter regions for T1, T2, and T3 elicited transcriptional activity in Mycobacterium smegmatis transformants. T1, T2, and T3, but no new transcript, were present in the M. tuberculosis cells that were grown under the stress conditions, which the pathogen is exposed to in granuloma in tuberculosis patients. It showed lack of modulation of MtftsE transcripts under the stress conditions tested, indicating that ftsE may not have a stress response-specific function in M. tuberculosis.

Introduction

Bacterial ftsE gene codes for a potential ATP-binding protein, the presence of which has been found in Escherichia coli [6, 11, 13], Pseudomonas putida [1], Neisseria gonorrhoeae [3], Aeromonas hydrophila [21], Mycobacterium tuberculosis [22], Synechococcus elongatus PCC 7942 [23], and Bacillus subtilis [10]. Several of these and other studies suggest that FtsE, in complex with the trans-membrane protein FtsX, participates directly or indirectly in diverse cellular processes. The FtsE-FtsX complex, in which FtsE has nucleotide binding domain, cannot yet be called as an importer or exporter type transporter protein since an associated substrate binding protein has not yet been identified [5]. In E. coli, the diverse processes in which FtsE participate include cell division under normal [11, 13] and under low osmolarity conditions [29], translocation of potassium pump proteins [43], and prevention of endogenous DNA damage [24]. Further, improper folding of FtsE, because of depletion of GroE, has been found to induce filamentous morphology in E. coli [9]. FtsE has also been found to be required for opsonophagocytosis in Aeromonas hydrophila [21], membrane restructuring in M. tuberculosis [26], regulation of cellular differentiation in Bacillus subtilis [10], and DNA binding in Neisseria meningitidis [18]. Considering its participation in such diverse-cellular functions, the demand for critical levels of FtsE and FtsX proteins could be of significance to any bacterial cell in general and to an intracellular human pathogen, like M. tuberculosis, in particular.

Regulation of expression of ftsE gene has been studied so far in E. coli [12], Pseudomonas putida PpG1 [1], and N. gonorrhoea [3]. The authors had earlier shown that FtsE gene of M. tuberculosis (MtftsE) could only partially complement growth defect of E. coliftsE temperature-sensitive strain, MFT1181 [22, 43]. However, co-expression of MtftsE, along with the gene for the transmembrane protein, FtsX (MtftsX), efficiently complemented the growth defect of MFT1181, indicating that the MtFtsE and MtFtsX proteins might be performing an associated function [22]. Although FtsX gene of M. tuberculosis (MtftsX) has been shown to be transcribed from a promoter inside the upstream gene, MtftsE [42], transcriptional features of MtftsE remain unknown. Therefore, as the first step towards determination of the levels of MtFtsE in cellular processes, in this study, the authors initiated transcriptional analyses of MtftsE in M. tuberculosis cells grown under stress conditions, which the pathogen is exposed to, in granuloma in tuberculosis patients [19, 28, 39, 46]. MtftsE transcripts were identified, their putative promoters were mapped, the putative promoter regions were cloned and their activity was confirmed, detected co-transcription of MtftsE with its immediate upstream gene, and examined transcriptional status of MtftsE under the stress conditions.

Materials and Methods

Bacterial Strains, Media, Culture Conditions

Mycobacterium tuberculosis H37Ra and Mycobacterium smegmatis mc2155 [40] cells were grown in Middlebrook 7H9 (Difco, USA) liquid medium supplemented with 0.2% glycerol, 0.05% Tween 80 and ADC (albumin, dextrose, catalase) enrichment or in Middlebrook 7H10 agar (Difco, USA) medium supplemented with OADC (oleic acid, albumin, dextrose, catalase) enrichment. For experiments under hypoxia, cells were grown in Dubos broth base (Difco, USA) supplemented with ADC. E. coli JM109 cells were grown in liquid or solid Luria–Bertani medium (Difco). Hygromycin (Sigma, USA) was used at 150 μg/ml for E. coli and 50 μg/ml for mycobacterium. Kanamycin (Sigma, USA) was used at 50 μg/ml. For culturing cells under various stress conditions in vitro, an exponentially growing M. tuberculosis culture of OD600 nm of 0.6 at 37°C was divided into a series of 20 ml of cultures. The cells were harvested, suspended in 10 ml of appropriate stress medium, and subjected to stress for 2 h at 37ºC in shaker, except for heat shock culture, which was kept at standing condition [19, 48]. The stress conditions were: (i) 10 mM H2O2 (oxidative stress), (ii) pH 5 (acid stress), (iii) 0.05% SDS (detergent stress), (iv) 50°C (high temperature heat shock), (v) 5 M NaCl final concentration (hyper-osmotic stress; [39]), and (vi) 0.2 μg/ml final concentration of mitomycin C (DNA damage induction; [29]). The bacterial cells, which were exposed to different stress conditions, were chilled in ice, harvested, washed in LETS buffer (100 mM LiCl, 10 mM EDTA, 10 mM Tris–HCl, pH 7.8, 1% SDS) [19], and used for further analysis. M. tuberculosis cells were cultured under hypoxic condition exactly as described [46]. The 12th day non-replicating persistent phase 2 (NRP2) cells were harvested, washed in Tween-saline (0.8% NaCl and 0.05% Tween 80) and used for total RNA preparation. For nutrient-depleted stationary phase culture, M. tuberculosis cells were grown in a rotary shaker at 37°C to OD600 nm of 2.5 (15 days) and then kept in standing non-shaking condition at 37°C for 30 additional days for gradual depletion of nutrients, along with micro-aerophilic submerged growth. The cells from the culture, which did not show appreciable lysis of the cells, were harvested at the end of 30 days and used for total RNA preparation.

Cloning of MtftsE Putative Promoter Sequences

The vector pMN406 contains mycgfp2+ gene [41] possesses the same fluorescence enhancing mutations as gfp+ [37] and was adapted to the mycobacterial codon usage. The imyc promoter of this vector was deleted to generate pMN406-ΔPimyc [33]. Three different MtftsE putative promoter regions, P1, P2, and P3, were cloned as transcriptional fusion to the reporter gene mycgfp2+ in pMN406, in place of imyc. Promoter regions P1 and P2 were cloned at the BamHI/XbaI sites of pMN406 vector, after annealing two sets of complementary cohesive-ended oligonucleotides, MtEP1f and MtEP1r, and MtEP2f and MtEP2r (Table 1), respectively. The promoter region P3 was cloned by PCR amplification of 403 bp region of the upstream gene MRA_3135 using primers MtEP3f and MtEP3r (Table 1), and cloned at the BamHI/XbaI sites in pMN406. Preparation of total cell lysate, quantitation of protein, and western blot analyses for MYCGFP2+ from these M. smegmatis transformants were carried out as described [22]. Anti-GFP antibody and secondary anti-rabbit-IgG-HRP were used at 1:1000 and 1:10000 dilution, respectively. Western blots were developed using enhanced chemiluminescence kit (ECL) kit (Sigma).
Table 1

Primers used in the study

Name

Sequence

MtEP1f

5′ ctagcccgttgatttcgcctgcccgctaatctcaccgctacac 3′

MtEP1r

5′ gatcgtgtagcggtgagattagcgggcaggcgaaatcaacggg 3′

MtEP2f

5′ ctagccggcacctaccccaaatccgagccaccgacccgttg 3′

MtEP2r

5′ gatccaacgggtcggtggctcggatttggggtaggtgccgg 3′

MtEP3f

5′ gctctagagtgaagctcagcaaccagaaacggcactgg 3′

MtEP3r

5′ cgggatcccggccgtcggacccggcc 3′

MtRa3135f

5′ gtgaagctcagcaaccagaaacggca 3′

MtEPE1r

5′ gccgacgatttgtactgcttggtgacatg 3′

MthspX-RTr

5′ gaccatcgcggaccataatgtcgac 3′

Mt-16SrRNA-RTr

5′ gaacaacgcgacaaaccacc 3′

MthspXf

5′ gcggatccatggccaccacccttcccgttc 3′

Mt-16SrRNA-RTf

5′ gcaccggccaactacgtg 3′

MtftsE2

5′ gcggaattctagagcgatccatcccgtagacgccacgctgttcgtc 3′

MtET3f

5′ ccggcacctaccccaaatccgag 3′

MtftsE1

5′ gcgggatccgatatcatgatcaccctggaccatgtcaccaagcagtacaaatcg 3′

All the primers were synthesised by Sigma-Aldrich India Pvt Ltd, Bangalore, India

Primer Extension Analysis, cDNA Synthesis, and Real Time PCR

Total RNA was isolated from M. tuberculosis H37Ra cells and M. smegmatis mc2155 transformant cells containing promoter constructs, grown to OD600 nm of 0.6 or exposed to different stress conditions. The 525 bp region, which spans complete open reading frame (ORF) of the upstream gene MRA_3135 (438 bp), the MRA_3135-MtftsE intergenic region (43 bp), and the first 44 nt of MtftsE ORF, was amplified from genomic DNA, with MtRa3135f and MtEPE1r primers (Table 1) and Pfu DNA polymerase (MBI Fermentas). It was used as the template for the cycle sequencing reactions in primer extension. The 5′ 32P-end-labelled reverse primer MtEPE1r, the 3′ end of which anneals at 15 nt downstream of the ‘A’ of the ATG of MtftsE gene, was used for primer extension and for cycle sequencing reactions, as described [32].

The reaction mixture for the synthesis of cDNA, for real time PCR of MthspX and Mt16S rRNA, consisted of 500 ng DNA-free total RNA, 2 μl of RNase H-minus M-MuLV Reverse Transcriptase buffer, and 2 μl each of the respective reverse primer (MthspX-RTr for MthspX and Mt-16SrRNA-RTr for Mt16S rRNA; each of 12.5 μM concentration; Table 1), with the volume made up to 14.6 μl. The reaction mixture was denatured at 65°C, snap-cooled on ice for 5 min, kept at the annealing temperature of respective primer for 5 min, and again snap-cooled. Subsequently, 2 μl of RNase H-minus M-MuLV Reverse Transcriptase buffer, 2 μl of 10 mM of dNTPs mixture, 20 U of RNase inhibitor, and 40 U of RNAse H-minus M-MuLV reverse transcriptase were added. The reaction mixture was incubated at 42°C for 60 min and heat inactivated at 70°C for 10 min.

The cDNA, thus synthesised, was used for real time PCR, with DyNamo SYBR Green qPCR kit (Finnzymes). The reaction mixture (20 μl) for real time PCR contained 10 μl of 2× master mix, 0.4 μl of ROX dye, 2 μl of forward primer (MthspXf for MthspX and Mt-16SrRNA-RTf for Mt16S rRNA; each at 12.5 μM concentration; Table 1), 2 μl of reverse primer (MthspX-RTr for MthspX, and Mt-16SrRNA-RTr for Mt16S rRNA; each at 12.5 μM concentration; Table 1), 1 μl of cDNA and water. Real Time PCR was performed for 40 cycles in ABI Prism and the data were analysed using 7000 SDS software (Applied Biosystems, USA). Real time RT-PCR Cτ values for 16S rRNA were used to normalise the real time RT-PCR Cτ values for MthspX.

Flow Cytometry Analysis

Flow cytometry analysis for the expression of MYCGFP2+ protein in the M. smegmatis mc2155 transformants, which were carrying different promoter constructs or vector control (pMN406-ΔPimyc), was carried out as described [33].

MRA_3135-MtftsE Co-Transcription Analysis

For co-transcription experiments, cDNAs were generated from 5 μg of DNA-free total RNA using 20 pmol each of MtftsE2 and MtEPE1r primers (Table 1), independently, in the presence of 20 U of Ribolock Ribonuclease Inhibitor [MBI Fermentas] and 200 U of RevertAid™ Premium Reverse Transcriptase [MBI Fermentas] at 42°C for 1 h. The enzyme was inactivated by incubation at 70°C for 10 min. The cDNA was used for PCR using the appropriate pair of primers (MtRa3135f and MtEPE1r to give 525 bp, MtET3f and MtEPE1r to give 127 bp, and MtftsE1 and MtftsE2 to give 690 bp; Table 1) that encompass different regions overlapping MRA_3135-MtftsE sequences. As RT-minus control, total RNA was used for PCR (30 cycles) for the same different regions overlapping MRA_3135-MtftsE sequences, with the same pair of primers. As the template control, PCR was carried out using primers alone without either total RNA or cDNA template.

Results and Discussion

Identification of Four MtftsE Primer Extension Products

Prior to transcriptional analyses, the authors confirmed that the nucleotide sequence at the genomic locus of MtftsE is identical between the avirulent M. tuberculosis H37Ra strain (NCBI Genome Browser: Ref Seq NC_009525) and the virulent M. tuberculosis H37Rv strain (NCBI Genome Browser: Ref Seq NC_000962) [51]. Therefore, the avirulent M. tuberculosis H37Ra strain, instead of the virulent strain, was used for the transcriptional analyses of MtftsE for want of biosafety facility. Primer extension analyses from two different concentrations (5 and 10 μg) of M. tuberculosis H37Ra total RNA using MtEPE1r primer (Fig. 1a) identified four-specific primer extension products, probably corresponding to four MtftsE transcripts, which were named T1, T2, T3, and T4 (Fig. 1b). T4 could be detected only when 10 μg of RNA was used, probably indicative of low abundance. Absence of primer extension product in the control experiment using mixture of E. coli tRNA and single-stranded sense strand of MRA_3135-MtftsE region (Fig. 1b, lane C), confirmed the specificity of primer extension reactions. T1 was found to originate at A-465, which is 15 nt upstream of the ATG of MtftsE and inside the 43 nt MRA_3135-MtftsE intergenic region (Fig. 2). The corresponding putative promoter P1 has TAATCT as the −10 sequence, which is 7 nt upstream of the start site, and TTGATT as the −35 sequence, with a 12 nt gap between −10 and −35 boxes (Fig. 2; Table 2). Putative P1 region has a high consensus to SigA recognition sequence, like in the case of several house-keeping and host-pathogen interaction regulatory genes of M. tuberculosis [31, 34, 44, 48, 49]. T2 was found to get initiated at G-434, which is 47 nt upstream of the ATG of MtftsE and just upstream of the −35 box of P1 (Fig. 2; Table 2). The putative promoter P2 is GC-rich with GAGCCA as the −10 sequence at 7 nt upstream of +1 site, and CGGCCG as the −35 sequence with 17-nt gap between the −10 and −35 sequences (Fig. 2; Table 2). T3 was found to originate at C-401 or C-402, which is 78 nt or 77 nt upstream of ATG of MtftsE and within the −35 sequence of P2. The putative P3 promoter contains CCGGGT as the −10 sequence and CGGCAC as the −35 sequence, with a 17-nt gap between them (Fig. 2; Table 2). Both P2 and P3 do not possess consensus to any of the identified canonical sigma factors of M. tuberculosis [8, 16, 20, 30, 34]. Sequence analysis of the promoter regions (Fig. 2) did not show any putative secondary structure region that can have a regulatory role in the expression of the gene, unlike in the case of ftsE gene of Brucella abortus that is regulated by global cell cycle transcriptional regulator, CtrA [2]. T4 seems to get initiated upstream of MRA_3135 gene and, therefore, the authors have not mapped the origin of T4 in this study.
https://static-content.springer.com/image/art%3A10.1007%2Fs00284-011-9897-1/MediaObjects/284_2011_9897_Fig1_HTML.gif
Fig. 1

Schematic representation of MRA_3135-MtftsE locus. a The annealing positions of the MtEPE1r, MtRa3135f, and MtEP3r primers (not drawn to scale) and the relative positions of the four identified transcripts, T1–T4, of ftsE are shown. b Primer extension analysis. Primer extension on RNA from exponential phase M. tuberculosis cells using primer MtEPE1r. Lane C, tRNA from E. coli, mixed with single-stranded sense strand of the same region of M. tuberculosis (negative control); lane Mt1, from 5 μg RNA; lane Mt2, from 10 μg RNA. Sequencing ladder was generated using the same primer on PCR product of combination of MtRa3135f and MtEPE1r primers. The sequencing lanes c, t, a, g correspond to the nucleotides on the reverse strand that is read

https://static-content.springer.com/image/art%3A10.1007%2Fs00284-011-9897-1/MediaObjects/284_2011_9897_Fig2_HTML.gif
Fig. 2

The nucleotide sequence of MRA_3135-intergenic region-part of MtftsE ORF, containing transcription start sites (shown in boxes) of T1, T2, and T3, and the promoters P1, P2, and P3. Shaded regions represent −10 and −35 sequences of the promoters. The underlined region is the primer MtEPE1r annealing site. The nucleotide positions start with the g of start codon gtg of MRA_3135. The start codons gtg of MRA_3135 and atg of MtftsE, are given in bold letters, by italics, and indicated by * ⇒ on top of the given nucleotides. Bold type, italicised nucleotides with underline represent stop codon tga of upstream MRA_3135. T4 is not indicated since it originates upstream of MRA_3135

Table 2

Promoter sequences and transcription start site of MtftsE gene

Promoter

−35 sequence

−10 sequence

Nt gap between −10 and −35 seq

Promoter consensus to

P1

TTGATT

TAATCT

12

SigA

P2

CGGCCG

GAGCCA

17

None

P3

CGGCAC

CCGGGT

17

None

T1, T2, and T3 are True Transcripts

In order to verify whether T1, T2, and T3 are true transcripts or whether they are products of RNA processing, the putative promoter regions encompassing the respective −10 and −35 sequences and +1 start sites of the individual transcripts (Figs. 1b, 2; Table 2) were cloned in pMN406-ΔPimyc vector upstream of mycgfp2+ reporter gene. Flow cytometry analysis of M. smegmatis transformants containing P1, P2, and P3 showed 42, 6.8, and 5.1% more MYCGFP2+ fluorescence, respectively, compared to the negative control cells harbouring pMN406-ΔPimyc (vector control lacking promoter; fraction of cells showing more fluorescence than the negative control) (Fig. 3a). Expression of MYCGFP2+, in M. smegmatis transformants for P1- or P2- or P3-mycgfp2+ fusion constructs, could also be detected using western blot analysis (Fig. 3b, lanes 3–5). Expression of mycgfp2+ driven by the 1.117 kb contiguous promoter regions of M. tuberculosisftsZ gene [32] was used as the positive control (Fig. 3b, lane 1). MYCGFP2+ expression was not observed from the pMN406-ΔPimyc vector that lacks Pimyc promoter (Fig. 3b, lane 2). These observations indicated that the cloned putative promoter regions indeed possess promoter activity and that T1, T2, and T3 are true transcripts and not products of RNA processing. As found in this study in M. tuberculosis, presence of multiple promoters for ftsE gene has been reported in E. coli [12] and N.gonorrhoeae [27].
https://static-content.springer.com/image/art%3A10.1007%2Fs00284-011-9897-1/MediaObjects/284_2011_9897_Fig3_HTML.gif
Fig. 3

Flow cytometry histograms of promoter activity. a Representative flow cytometry histograms of in vivo activity of the independently cloned promoter regions P1, P2, and P3 in the promoter probe vector pMN406. The x-axis represents events and the y-axis represents fluorescence intensity. Blank peaks represent activity of the promoters and grey peaks represent the activity from pMN406-ΔPimyc (negative control). The average percentage of MYCGFP2 + fluorescence in M. smegmatis transformants, more than that when compared to the negative control cells harboring pMN406-ΔPimyc (vector control), is given for the respective cloned promoter. Dot plots were analysed using WinMDI software, Version 2.8. b Western blot analyses for MYCGFP2 reporter protein (using anti-GFP antibody) expressed from: 1.117 kb M. tuberculosisftsZ promoter region as positive control (lane 1), vector control (lane 2), promoter regions P1 (lane 3), P2 (lane 4), and P3 (lane 5)

Co-transcription of MtftsE and MRA_3135

Since T4 originates upstream of MRA_3135, the possibility of co-transcription of MtftsE and MRA_3135 was examined. For this purpose, cDNAs were generated using MtEPE1r and MtftsE2 primers (Table 1; Fig. 4a). The cDNAs were amplified independently using three sets of primers (Table 1). These were MtftsE1-MtftsE2 (positive control), MtEPE1r and MtRa3135f, and MtET3f and MtEPE1r primer pairs (Fig. 4a). These three primer sets, respectively, gave the expected size products of 690 bp (MtftsE ORF; positive control), 525 bp (438 bp of MRA_3135 ORF + 43 bp of MRA_3135-MtftsE intergenic region + 44 bp of 5′ portion of MtftsE ORF), and 127 bp (40 bp of 3′ portion of MRA_3135 + 43 bp of MRA_3135-MtftsE intergenic region + 44 bp of 5′ portion of MtftsE ORF) (Fig. 4b, lanes 1–3, respectively). The RT-minus and template-minus negative control samples did not yield any PCR product (Fig. 4b, lanes 4 and 5, respectively). These observations revealed that MRA_3135 and MtftsE are co-transcribed in M. tuberculosis cells. Similar to the co-transcription of MtftsE with the upstream gene MRA_3135, co-transcription of ftsE genes of N. gonorrhoeae and E. coli with respective upstream gene, ftsY (in E. coli) and tlpA (in N. gonorrhoea) has been reported [3, 12, 27].
https://static-content.springer.com/image/art%3A10.1007%2Fs00284-011-9897-1/MediaObjects/284_2011_9897_Fig4_HTML.gif
Fig. 4

Co-transcription of MRA_3135 and MtftsE. a Schematic representation of the combination of RT-PCR primers \and the size of the products. MtRa3135f and MtEPE1r, MtftsE1 and MtftsE2, and MtET3f and MtEPE1r, primers will give 525, 690, and 127 bp, from the MRA_3135-MtftsE region. The origins of T1, T2, T3, and T4 are shown by right-angled arrows. b cDNAs synthesised with MtftsE2 or MtEPE1r primer. SM-Φ × 174 DNA/HaeIII digest size marker. Lanes 1, PCR product of MtftsE1-MtftsE2 primer pair (690 bp); 2, PCR product of MtRa3135f-MtEPE1r primer pair (525 bp); 3, PCR product of MtET3f-MtEPE1r primer pair (127 bp); 4, PCR using MtRa3135f-MtEPE1r primer pair on RNA (minus Reverse Transcriptase); 5, PCR using MtRa3135f-MtEPE1r primer pair without RNA template (template control)

MtftsE Transcripts Under Stress Conditions

In host cells, M. tuberculosis experiences stress conditions, namely low pH, reactive nitrogen and oxygen species and other DNA damaging conditions, surface structure damaging conditions like toxic, free fatty acids and peptides/proteins, and above all, reduced oxygen pressure (hypoxia) and nutrient depletion [19, 47, 50]. In E. coli cells, EcFtsE has been implicated to have some role in cell division [36], a process that gets arrested in dormant M. tuberculosis cells in response to hypoxia [45, 46] and nutrient depletion [4, 15]. Therefore, several bacterial cellular processes, in which FtsE is involved [11, 13, 18, 24, 26, 36, 43], may be influenced by altered expression of ftsE under stress conditions. For instance, presence of specific ftsE transcripts has been demonstrated in N. gonorrhoeae, which were exposed to stress conditions, reflecting the environment of genitourinary tract, namely anaerobiosis, presence of isoleucine, urea, and pH 6 [27]. Similarly, E. coliftsE has been found to be required for cell division under low osmolarity condition [29], although it was non-essential for cell division under optimal growth and high osmolarity conditions.

In view of these observations, it was examined whether M. tuberculosis cells would synthesise all the three transcripts, T1, T2, and T3, or any new transcript under the stress conditions (see Materials and Methods). Primer extension experiments on total RNA from M. tuberculosis cells, which were exposed to the stress conditions, showed the presence of T1, T2, and T3 transcripts, and no new transcript, under all the stress-conditions tested (Fig. 5). The highly upregulated levels (56- and 252-fold, respectively, in the M. tuberculosis cells under NRP2 stage and nutrient-depleted stationary phase) of MthspX mRNA, which is the molecular marker for these two conditions [7, 14, 15, 17, 25, 38, 45], confirmed that the cells were in NRP2 stage and nutrient-depleted stationary phase. High-density transposon mutagenesis had shown that MtftsE is not an essential gene for optimal growth of M. tuberculosis [35]. Neither does overexpression of MtftsE, which could complement growth defect of E. coliftsE temperature-sensitive strain, MFT1181 [22, 43], cause septation block in E. coli cells (Mir and Ajitkumar, unpublished data). These observations suggest that, unlike in the case of N. gonorrhoeae [27], M. tuberculosis cells do not seem to require modulation of MtftsE expression under the stress-conditions tested. Although this study was not aimed at identification of the physiological role of MtftsE, from the maintenance of all the three MtftsE transcripts under different stress conditions, it may be speculated that MtftsE may not be involved in stress-responsive function in M. tuberculosis cells.
https://static-content.springer.com/image/art%3A10.1007%2Fs00284-011-9897-1/MediaObjects/284_2011_9897_Fig5_HTML.gif
Fig. 5

Primer extension analyses of T1, T2, and T3, using MtEPE1r primer on total RNA from M. tuberculosis cells exposed to different stress conditions, and from exponential phase (control). The equal amounts (3 μg from each sample) of RNA used for analyses are shown below the respective lanes under the panels

Copyright information

© Springer Science+Business Media, LLC 2011