Annals of Hematology

, Volume 92, Issue 8, pp 1063–1069

The clinical characteristics and prognostic significance of MN1 gene and MN1-associated microRNA expression in adult patients with de novo acute myeloid leukemia

Authors

  • Lili Xiang
    • Department of HematologyThe First People’s Hospital of Changzhou, Third Affiliated Hospital of Suzhou University
  • Man Li
    • Department of HematologyThe First People’s Hospital of Changzhou, Third Affiliated Hospital of Suzhou University
  • Yan Liu
    • Department of HematologyThe First People’s Hospital of Changzhou, Third Affiliated Hospital of Suzhou University
  • Jiangnong Cen
    • Jiangsu Institute of HematologyThe First Affiliated Hospital of Suzhou University
  • Zixing Chen
    • Jiangsu Institute of HematologyThe First Affiliated Hospital of Suzhou University
  • Xiao Zhen
    • Laboratory of TumorThe First People’s Hospital of Changzhou, Third Affiliated Hospital of Suzhou University
  • Xiaobao Xie
    • Department of HematologyThe First People’s Hospital of Changzhou, Third Affiliated Hospital of Suzhou University
  • Xiangshan Cao
    • Department of HematologyThe First People’s Hospital of Changzhou, Third Affiliated Hospital of Suzhou University
    • Department of HematologyThe First People’s Hospital of Changzhou, Third Affiliated Hospital of Suzhou University
Original Article

DOI: 10.1007/s00277-013-1729-x

Cite this article as:
Xiang, L., Li, M., Liu, Y. et al. Ann Hematol (2013) 92: 1063. doi:10.1007/s00277-013-1729-x

Abstract

This study aimed to determine the clinical characteristics and prognostic significance of the meningioma 1 (MN1) gene and MN1-associated microRNA expression in Chinese adult de novo acute myeloid leukemia (AML) patients. The expression level of MN1, microRNA-20 (miR-20a), and microRNA-181b (miR-181b) in bone marrow mononuclear cells was measured in 158 newly diagnosed AML patients and 20 cases of normal healthy donors by real-time quantitative reverse transcriptase polymerase chain reaction. All AML patients significantly overexpressed MN1 at the level of 0.01983 (P < 0.001) compared with normal controls. High MN1 expression was associated with spleen involvement (P = 0.037), NPM1 wild type (P = 0.001), lower miR-20a expression levels (P = 0.015), and higher miR-181b expression levels (P = 0.035). MiR-20a (P = 0.029) and miR-181b (P = 0.017) overexpressed in the bone marrow cells of patients with certain subtypes of AML compared with healthy donors. High MN1 expressers had lower complete remission (CR) rates and shorter overall survival (OS) within the Southwest Oncology Group classification. In multivariable models, high MN1 expression was associated with worse CR rates (P = 0.01), relapse-free survival (RFS; P = 0.02), and OS (P = 0.02); high miR-20a expression was associated with higher CR rates (P = 0.008) and longer OS (P = 0.04), whereas high miR-181b expression was associated with lower CR rates (P = 0.03), and shorter RFS (P = 0.045) and OS (P = 0.017). High MN1 expression confers worse prognosis in Chinese adult patients with de novo AML. MN1 gene and MN1-associated microRNAs provide clinical prognosis of AML patients and may refine their molecular risk classification.

Keywords

Acute myeloid leukemiaMeningioma 1MicroRNAsReal-time quantitative reverse transcriptase polymerase chain reaction

Introduction

The meningioma 1 (MN1) gene is localized at human chromosome 22 and encodes a transcriptional coregulator complex with the nuclear receptor RAR-RXR or the vitamin D receptor [13]. A mouse model showed that MN1 overexpression participated in the development of acute myeloid leukemia (AML) in cooperation with CBFB-MYH11 gene fusion [4]. It has been also shown in a mouse model that the fusion protein MN1-TEL can promote growth of primitive hematopoietic progenitor cells and, in cooperation with HOXA9, induce AML [5]. Heuser et al. demonstrated that MN1 overexpression rapidly induced lethal AML in mice [6]. MicroRNAs (miRNAs) are a novel class of small, single-stranded noncoding RNA molecules containing about 22 nucleotides that play evolutionarily conserved roles in cellular development, function, and malignant transformation. MiRNAs guide the RNA-induced silencing complex onto the 3′-untranslated region of target mRNAs by complimentary base pairing of at least six to eight nucleotides and thus negatively regulate gene expression, by translation repression or mRNA degradation [7, 8]. MiRNAs can regulate hematopoietic differentiation in almost every stage, so their aberrant expression has been associated with many hematological malignancies.

Over the past years, several studies have shown that cytogenetic abnormalities were the most important prognostic factors in AML [912]. Heuser et al. [13] reported that high MN1 expression predicted poor outcome in acute myeloid leukemia with normal cytogenetics (CN-AML). Furthermore, Langer et al. [14] have found that lower expression levels of microRNA-20 (miR-20a) were associated with higher MN1 levels. It was reported that microRNA-181b (miR-181b) overexpressed in acute lymphocytic leukemia [15, 16] and was a biomarker of disease progression in chronic lymphocytic leukemia (CLL) [17]. However, the features of miR-181b expression in AMLs are uncertain now. Herein, we measured the MN1 and miR-20a, and miR-181b expression levels of the bone marrow (BM) samples from de novo adult AML patients in order to analyze the impact on clinical outcome of MN1 expression within the Southwest Oncology Group (SWOG) and the relationship of miRNA expression with MN1 expression levels, as well as to gain the clinical characteristics and prognostic significance of the MN1 gene and MN1-associated miRNA expression in Chinese adult de novo AML patients.

Methods

Patients and treatment

After ethical committee approval and informed consent, diagnostic BM samples of 158 adult patients (aged 16–60 years) with de novo AML (French–American–British [FAB] classification M0–M2, M4–M6) and 20 healthy donors were obtained from The First People's Hospital of Changzhou and The First People's Hospital of Suzhou, and material available were analyzed for MN1 and miR-20a, miR-181b expression. All patients received intensive, response-adapted double induction and one consolidation therapy. Double induction therapy consisted of two courses of DA (daunorubicin, 45–60 mg/m2/day, days 1 through 3, and cytarabine, 100–150 mg/m2/day, days 1 through 7) or IA (idarubicin, 8–12 mg/m2/day, days 1 through 3, and cytarabine, 100 mg/m2/day, days 1 through 7). Patients with a poor response (do not achieve complete remission, CR) to the double induction therapy were assigned a course of FLAG (fludarabin, 25 mg/m2/day, days 1 through 5; cytarabine, 1 g/m2/day, days 1 through 5; granulocyte colony-stimulating factor, 5 μg/kg/day starting from day 0 to neutropenia recovery) followed by consolidation therapy which consisted of high-dose cytarabine (cytarabine, 3 g/m2, on days 1 through 6) or myeloablative therapy (busulfan/cyclophosphamide) followed by autologous stem cell transplantation or a second course of FLAG in patients who responded to the previous course of FLAG.

Molecular markers analysis

Diagnostic samples from all patients with AML were analyzed for the presence or absence of additional molecular markers such as FLT3 internal tandem duplication (FLT3-ITD) [18] and mutations in the NPM1 genes (exon 12 mutations) [19]. The expression levels of the WT1 gene were also evaluated centrally in BM samples as previously described [20].

Real-time RT-PCR to measure MN1 and microRNA expression levels

The expression level of MN1 and microRNAs in bone marrow mononuclear cells was measured in 158 cases of newly diagnosed AML patients and 20 cases of normal healthy donors by reverse transcriptase polymerase chain reaction (RT-PCR). Total RNA was extracted using TRIZOL reagent (Invitrogen, Paisley, UK) from stored, frozen, Ficoll-separated mononuclear AML cells. MuLV reverse transcriptase (Fermentas, Hanover, MD) was used to synthesize cDNA from total RNA. Real-time quantitative RT-PCR was carried out on the LightCycler (Roche Diagnostics, Mannheim, Germany, used for quantification of MN1 expression in patient samples) and the 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA; used to measure microRNA expression). Primers were manufactured by Sangon Biotech Co. (Shanghai, China). Primer sequences (5′–3′) are as follows: MN1 forward primer, CAGAACCCCAACAGCAAAGAAG; MN1 reverse primer, CACGTCGTCTGTGCAGTGGAC; MN1 TaqMan probe, ACGACCTCCCTGCAAACAAGGCCTC; GAPDH forward primer, GGAAGGTGAAGGTCGGAGTC; GAPDH reverse primer, CGTTCTCAGCCTTGACGGT; and GAPDH TanMan probe, TTTGGTCGTATTGGGCGCCTG. The reactions were carried out in duplicate under the following conditions: 95 °C for 3 min (MN1) or 5 min (GAPDH), then 40 cycles of 95 °C for 10 s, 61 °C (MN1) or 58 °C (GAPDH) for 10 s (MN1) or 15 s (GAPDH), and 40 °C for 1 min. Quantitative real-time RT-PCR amplifications of MN1 and GAPDH were performed using sevenfold dilutions covering the expected detection range with a reference cDNA (NB4 cell line) to obtain standard curves. MN1 copy numbers were normalized to GAPDH copy numbers. MiR-20a and miR-181b expression was performed using the EzOmicsTM miRNA qPCR Detection Primer Set and EzOmicsTM One-Step qPCR Kit as described in the manufacturer's instructions (Biomics, Nantong, China), respectively. The housekeeping U6 gene transcript was used to normalize the results, and the relative expression of MiRNAs was determined with the 2−△△CT [21].

Statistical analysis

According to the normalized median MN1 expression levels (normalized copy number, MN1 transcripts per GAPDH, 0.019836; range, 0.000005–1.387451), the AML samples were divided into two groups: a high MN1 expression group with MN1 values above the median value and a low MN1 expression group with MN1 values below the median value. The definition of CR followed the recommended criteria [22], and we defined RFS as the interval from CR achievement until relapse or death, regardless of cause, and overall survival (OS) as the date on study until death. Pairwise comparisons between patient characteristics (by referring to clinical characteristics and laboratory parameters) were performed by Wilcoxon rank-sum test for continues variables and chi-square test/Fisher exact test for categorical variables. Estimated probabilities of RFS and OS were calculated using the Kaplan–Meier method. Multivariable logistic regression models were constructed to analyze factors related to the probability of achieving CR, and multivariable Cox proportional hazards models were constructed to analyze factors important for RFS and OS. Variables considered for inclusion in the logistic and Cox multivariable models were significant at α = 0.10 from the univariable models. All models were constructed using the forward selection procedure. Variables remaining in the final models were significant at α = 0.05. For CR attainment, estimated odds ratios (OR) and, for survival end points, hazard ratios (HR) with their corresponding 95 % confidence intervals (95 % CIs) were obtained for each significant prognostic factor. The two-sided level of significance was set at P values less than 0.05. The statistical analyses were performed with the statistical software SPSS 17.0.

Results

The characteristics of the MN1 expression in acute myeloid leukemias

At diagnosis, the MN1 expression levels in AML patients were significantly higher than those in the normal control group (P < 0.001), and the expression of MN1 was higher in subtypes of AML (Table 1). Higher MN1 expression was associated with higher frequency of spleen involvement (P = 0.037; Table 2). There were no other significant differences in presenting clinical characteristics between patients with high or low MN1 expression.
Table 1

Characteristics of MN1 expression levels in all AML patients

Classification

Case number

Median MN1 expression (range)

P valuea

All patients

158

0.01984 (0.000005–1.387451)

<0.001

M0

1

0.20718

ND

M1

22

0.00666 (0.000688–0.498392)

0.001

M2

66

0.01398(0.000008-0.905749)

<0.001

M4

23

0.01947 (0.000005–1.387451)

0.001

M5

38

0.03864 (0.000042–0.456028)

0.001

M6

8

0.10607 (0.000927–0.239261)

0.002

Controls

20

0.00002 (0–0.076530)

 

ND not done

aP values for continuous variables are from the Wilcoxon rank-sum test, evaluating the variance of the MN1 expression between AML patients and the normal control group. For tests with a P value <0.05, higher MN1 expression groups appear in bold

Table 2

Clinical characteristics according to MN1 expression status in all AML patients

Characteristic

MN1 high (n = 79)

MN1 low (n = 79)

P valuea

Median age, years

46

38

0.07

 Range

18–60

16–60

Sex, n (%)

  

0.08

 Female

49 (62)

38 (48)

 Male

30 (38)

41 (52)

Median WBC, ×109/L

5.66

14.77

0.06

 Range

0.28–211

0.25–304.2

Median hemoglobin, g/L

73

75

0.63

 Range

31–128

1.4–127

Median platelet count, ×109/L

57

32.5

0.39

 Range

0–194

6–124

Median bone marrow blasts, %

66

65.65

0.35

 Range

12–95

18–91

Median LDH, μ/L

305

356.5

0.17

 Range

103–2,560

12–2,122

Liver involvement, n (%)

  

0.20

 No

68 (86)

73 (92)

 Yes

11 (14)

6 (8)

Spleen involvement, n (%)

  

0.037

 No

60 (76)

70 (89)

 Yes

19 (24)

9 (11)

Nodes involvement, n (%)

  

0.48

 No

67 (85)

70 (89)

 Yes

12 (15)

9 (11)

aP values for continuous variables are from Wilcoxon rank-sum test. P values for categorical variables are from chi-square test, evaluating the presence of any linear relationship between the MN1 expression and the variable tested. For tests with a P value <0.05, the characteristic associated with higher MN1 expression appears in bold

The characteristics and prognostic significance of miR-20a and miR-181b expression in AMLs

The AML samples significantly overexpressed miR-20a (P = 0.029) and miR-181b (P = 0.017) compared with healthy donors. MiR-20a and miR-181b levels in different subtypes of AML were next ascertained using the FAB classification system. Patients with AML-M4 (P = 0.041) and AML-M5 (P = 0.018) exhibited significant overexpression of miR-20a, and patients with AML-M1 (P = 0.001), AML-M5 (P = 0.002), and AML-M6 (P < 0.001; Table 3) exhibited significant overexpression of miR-181b compared with normal samples. Multivariate analysis confirmed that high miR-20a expression of AMLs was a prognostic value for higher CR rates (P = 0.008) and longer OS (P = 0.04), whereas high miR-181b expression was a prognostic value for lower CR rates (P = 0.03) and shorter RFS (P = 0.045) and OS (P = 0.017; Table 6).
Table 3

Characteristics of miR-20a and miR-181b expression levels in all AML patients

Classification

Case number

Median miR-20a expression

P valuea

Median miR-181b expression

P valuea

All patients

158

1.6615

0.029

2.5084

0.017

M0

1

0.2995

ND

8.9886

ND

M1

22

1.7295

0.104

3.7599

0.001

M2

66

1.5961

0.082

1.8601

0.155

M4

23

2.5984

0.041

1.1321

0.450

M5

38

1.7982

0.018

3.8217

0.002

M6

8

1.4180

0.416

5.5795

<0.001

Controls

20

0.9039

 

1.2628

 

ND not done

aP values for continuous variables are from Wilcoxon rank-sum test, evaluating the variance of miRNA expression between AML patients and the normal control group. For tests with a P value <0.05, higher miRNA expression groups appear in bold.

Associations of MN1 expression with molecular characteristics and clinical outcome in AMLs

Higher MN1 expression was associated with lower frequency of NPM1 mutations (P = 0.001), lower miRNA-20a expression levels (P = 0.015), and higher miRNA-181b expression levels (P = 0.035; Table 4). We analyzed the impact on clinical outcome of MN1 expression within the SWOG classification [23]. Within the favorable and intermediate-risk groups, we observed significant difference in CR rates (47 vs 81 %, P = 0.026; 53 vs 75 %, P = 0.040, respectively), OS (2-year OS rates, 26 vs 62 %, P = 0.024; 26 vs 53 %, P = 0.018, respectively, Table 5) between high MN1 and low expressers. Within the adverse risk group, patients with high MN1 expression had a lower CR rate (36 vs 72 %, P = 0.024), a trend toward shorter RFS (2-year RFS rates, 25 vs 69 %, P = 0.080), and significantly shorter OS (2-year OS rates, 18 vs 50 %, P = 0.033; Table 5). Furthermore, in a multivariable analysis (Table 6), higher MN1 expression levels were associated with lower CR rates (P = 0.01), after adjusting for miR-20a expression (P = 0.008) and miR-181b expression (P = 0.03), with shorter RFS (P = 0.02), after adjusting for miR-181b expression (P = 0.045), WT1 expression (P = 0.002), and FLT3-ITD (P < 0.001), and with shorter OS (P = 0.02), after adjusting for miR-20a expression (P = 0.04), miR-181b expression (P = 0.017), FLT3-ITD (P = 0.003), NPM1 mutations (P = 0.01) and WBC (P = 0.005).
Table 4

Relationship of molecular characteristics with MN1 expression levels in all AML patients

Characteristic

MN1 high (n = 79)

MN1 low (n = 79)

P valuea

NPM1, n (%)

  

0.001

 Wild type

64 (81)

47 (60)

 Mutated

15 (19)

32 (40)

FLT3-ITD, n (%)

  

0.37

 Negative

55 (70)

60 (76)

 Positive

24 (30)

19 (24)

Median WT1 expression

0.016179

0.028732

0.40

 Range

0.007936–0.113443

0.007679–0.064282

Median miR-20a expression

0.3943

0.7434

0.015

 Range

0.0216–26.1402

0.0192–20.8923

Median miR-181b expression

2.2432

1.6973

0.035

 Range

0.0642–10.1965

0.0395–13.9694

aP values for continuous variables are from Wilcoxon rank-sum test. P values for categorical variables are from chi-square test, evaluating the presence of any linear relationship between the MN1 expression and the variable tested. For tests with a P value <0.05, the characteristic associated with higher MN1 expression appears in bold

Table 5

Clinical outcome according to MN1 expression status in all AML patients within the SWOG classification

Outcome

MN1 high

MN1 low

P valuea

Favorable risk group

n = 19

n = 21

 

 CR rate, n (%)

9 (47)

17 (81)

0.026

 RFS

  

0.429

 Median, years

0.6

0.9

 

 Relapse free at 2 years, %

33

53

 

 OS

  

0.024

 Median, years

1.1

1.5

 

 Alive at 2 years, %

26

62

 

Intermediate-risk group

n = 38

n = 40

 

 CR rate, n (%)

20 (53)

30 (75)

0.04

 RFS

   

 Median, years

0.4

0.6

0.133

 Relapse free at 2 years, %

35

57

 

 OS

  

0.018

 Median, years

0.7

1.0

 

 Alive at 2 years, %

26

53

 

Adverse risk group

n = 22

n = 18

 

 CR rate, n (%)

8 (36)

13 (72)

0.024

 RFS

   

 Median, years

0.3

0.7

0.08

 Relapse free at 2 years, %

25

69

 

 OS

  

0.033

 Median, years

0.6

0.8

 

 Alive at 2 years, %

18

50

 

aP values for categorical variables are from chi-square test/Fisher exact test, evaluating the variance of CR rates, RFS, and OS. For tests with a P value <0.05, high MN1 expression associated with lower CR rates and shorter RFS and OS appears in bold

Table 6

Multivariable analysis for clinical outcome in all AML patients

Variables in final model by end point

OR

95 % CI

P value

CRa

MN1 expression

0.35

0.16, 0.78

0.01

miR-20a expression

1.22

1.09, 1.34

0.008

miR-181b expression

0.54

0.34, 0.86

0.03

RFSb

MN1 expression

2.36

1.17, 4.68

0.02

miR-181b expression

1.96

1.13, 3.72

0.045

WT1 expression

2.53

1.40, 4.80

0.002

FLT3-ITD (positive vs negative)

2.67

1.65, 5.61

<0.001c

OSd

MN1 expression

1.60

1.06, 2.43

0.02

miR-20a expression

0.41

0.16, 0.97

0.04

miR-181b expression

2.01

1.21, 3.33

0.017

FLT3-ITD (positive vs negative)

2.39

1.45, 4.94

0.003c

NPM1 (wild type vs mutated)

2.61

1.51, 5.29

0.01c

WBC

1.36

1.12, 1.68

0.005

Multivariable analysis was performed by including those variables with a P value <0.10 in the univariable analysis. Only variables with a P value <0.05 in the Cox regression model were considered as having an independent prognostic value. OR < 1 (>1) indicates lower (higher) CR rates for the higher values of the continuous variables and the first category listed for the categorical variables. HR < 1 (>1) indicates lower (higher) risk for an event for the higher values of the continuous variables and the first category listed for the categorical variables

CI confidence interval

aVariables considered in the model based on univariable analyses were MN1, miR-20a, miR-181b, FLT3-ITD (positive vs negative), WBC (50 unit increments), age, and hemoglobin

bVariables considered in the model based on univariable analyses were MN1, miR-20a, miR-181b, WT1, FLT3-ITD (positive vs negative), NPM1 (wild-type vs mutated),WBC (50 unit increments), and spleen involvement

cDoes not meet the proportional hazard assumption. For RFS, the HR for FLT3-ITD is reported at 9 months; for OS, the HR for FLT3-ITD is reported at 1 year; NPM1 is reported at 1.5 years

dVariables considered in the model based on univariable analyses were MN1, miR-20a, miR-181b, WT1, FLT3-ITD (positive v negative), NPM1 (wild type vs mutated),WBC (50 unit increments), age, hemoglobin, percentage of blood blasts, and spleen involvement

Discussion

Previous studies reported MN1 overexpression in subtypes of AML [24, 25]. Our results also showed MN1 expression was significantly higher in subtypes of AML in a Chinese cohort. Heuser et al. reported that high MN1 expression predicted poor outcome in younger (<60 years) adults with CN-AML [13] and high MN1 expression associated with lower CR rates and shorter disease-free survival, OS, and event-free survival in younger patients with CN-AML [14]. Here, we observed the impact on clinical outcome of MN1 expression according to the SWOG and found that AML patients of favorable, intermediate, and adverse risk groups with high MN1 expression have lower CR rates and shorter OS than those patients with low MN1 expression. Furthermore, in multivariable analyses, we observed that MN1 expresser status remained a significant prognosticator for CR attainment, RFS, and OS, even in the context of other molecular markers, including miR-20a, miR-181b and WT1 expression, FLT3-ITD and NPM1 mutations, and WBC. These results indicated that MN1 gene was a valuable prognostic determinant in AML and may refine the SWOG classification. We also observed associations of MN1 expression with molecular biologic features and found that there was an association of high MN1 expression with wild-type NPM1 and lower miRNA-20a expression and higher miRNA-181b expression.

In the past years, miRNAs have been shown to be aberrantly expressed in AML [26, 27], and miR-181b was a biomarker of disease progression in CLL [17]. We found that miR-20a and miR-181b overexpressed in subtypes of AML patients compared with healthy donors. The two AML subgroups found to be overexpressing miR-20a are characterized as myelomonocytic (M4) and monocytic (M5), and the expression of miR-181b was higher in patients with the myeloid FAB type M1, the monocytic FAB type M5, and the erythrocytic FAB type M6. These results demonstrated that miR-20a and miR-181b might participate in regulation of monocytic proliferation and differentiation, and pay a pivotal role in malignant transformation. Moreover, it is of note that miR-20a and miR-181b may also be elevated in other subtypes of AML where we did not have enough samples to draw such a conclusion. Both microRNA signatures and a single microRNA have been shown to supply prognostic information. We found that high miR-20a expression was associated with higher CR rates and longer OS, whereas high miR-181b expression was associated with lower CR rates, and shorter RFS and OS.

In conclusion, we show that high levels of MN1 expression are an important prognostic marker in Chinese adult patients with de novo AML. Prognostic impact of MN1 expression is especially predominant in patients within the SWOG classification. MN1 gene and MN1-associated microRNAs provide clinical prognosis of AML patients and may refine molecular risk classification.

Acknowledgments

This work was supported in part by a grant in aid from the 831 projects of the Municipal Committee of Changzhou (no. ky201005). The authors thank the Jiangsu Institute of Hematology for support.

Conflict of interest

The authors declare that they have no conflict of interest.

Copyright information

© Springer-Verlag Berlin Heidelberg 2013