Annals of Hematology

, Volume 91, Issue 8, pp 1235–1243

Detection of ETV6 gene rearrangements in adult acute lymphoblastic leukemia

Authors

  • Min-hang Zhou
    • Department of HematologyChinese PLA General Hospital
  • Li Gao
    • Department of HematologyChinese PLA General Hospital
  • Yu Jing
    • Department of HematologyChinese PLA General Hospital
  • Yuan-yuan Xu
    • Department of HematologyChinese PLA General Hospital
  • Yi Ding
    • Department of HematologyChinese PLA General Hospital
  • Nan Wang
    • Department of HematologyChinese PLA General Hospital
  • Wei Wang
    • Department of HematologyChinese PLA General Hospital
  • Mian-yang Li
    • Department of Clinical LaboratoryChinese PLA General Hospital
  • Xiao-ping Han
    • Department of HematologyChinese PLA General Hospital
  • Jun-zhong Sun
    • Department of OncologyChinese PLA General Hospital
    • Department of HematologyChinese PLA General Hospital
    • Department of HematologyChinese PLA General Hospital
Original Article

DOI: 10.1007/s00277-012-1431-4

Cite this article as:
Zhou, M., Gao, L., Jing, Y. et al. Ann Hematol (2012) 91: 1235. doi:10.1007/s00277-012-1431-4

Abstract

ETV6 is an important hematopoietic regulatory factor and ETV6 gene rearrangement is involved in a wide variety of hematological malignancies. In this study, we sought to investigate the incidence of ETV6-associated fusion genes in B- and T-lineage acute lymphoblastic leukemia (ALL) by multiplex-nested reverse transcription-polymerase chain reaction (RT-PCR) in 176 adult ALL patients. Total RNA was extracted from bone marrow samples of ALL patients including 136 B- and 40 T-lineage ALL, and ETV6 fusion genes were detected by multiplex-nested RT-PCR. Changes of ETV6 fusion gene mRNA transcript levels were examined by real-time RT-PCR. We detected a total of 15 ETV6 gene rearrangements with a positive rate of 8.5%, involving seven ETV6-associated fusion genes in 13 B-ALL (13/136, 9.6%) and 2 T-ALL patients (2/40, 5.0%). ETV6–RUNX1 were observed in six cases (3.4%), ETV6–JAK2 in three cases (1.7%), ETV6–ABL1 in two cases (1.1%), and ETV6–ABL2, ETV6–NCOA2, ETV6–SYK, and PAX5–ETV6 each in one case (0.6%). ETV6–JAK2 was found in both B-ALL and T-ALL patients. Furthermore, real-time quantitative RT-PCR assays showed that the ETV6–RUNX1 mRNA transcript levels decreased during conventional chemotherapy or hematopoietic stem cell transplantation. This study shows that multiplex-nested RT-PCR is an effective and accurate tool to identify ETV6 rearrangements in adult ALL, which provides some clues into the diagnosis and prognosis of ALL but also molecular markers for the detection of minimal residual disease in adult ALL.

Keywords

Multiplex-nested RT-PCRAcute lymphoblastic leukemiaETV6 gene rearrangementsMinimal residual disease

Introduction

Acute lymphoblastic leukemia (ALL) is characterized by a defect in the differentiation of precursor B and T cells with resultant accumulation of proliferating leukemia cells in the bone marrow and ultimate replacement of normal elements in the bone marrow. Recurrent defects including chromosomal translocations, aneuploidies, and gene-specific alterations generate molecular subgroups of B- and T-ALL with differing clinical courses and distinct responses to therapy [1]. Several molecular methods have recently been developed that allow the identification of leukemia-associated gene aberrations. Fusion genes, which are the products of chromosomal translocations, are present in 30–50% of patients with ALL and represent the most accurate predictors of clinical diagnosis and prognosis [2]. Despite the availability of novel molecular markers that have emerged from studies such as gene expression profiling [39], recurrent chromosomal abnormalities are still the most important prognostic factors and risk factors for different protocol assignments. Although conventional cytogenetic analysis is the standard method for identifying chromosomal translocations, some translocations such as ETV6–RUNX1 cannot be identified by routine cytogenetic studies [10]. Therefore, it is extremely important to develop rapid and efficient and reliable diagnostic methods that can identify these recurrent chromosomal translocations. Molecular screening by multiplex-nested reverse transcription-polymerase chain reaction (RT-PCR) has been increasingly used to complement conventional karyotyping [11, 12].

ETV6 (previously named as TEL) belongs to the ETS family of transcription factors. It is an important hematopoietic regulatory factor [13, 14]. ETV6 gene rearrangement is involved in a wide variety of hematological malignancies [15, 16]. The ETV6–RUNX1 (TEL–AML1) fusion gene, which results from the chromosomal translocation t (12; 21) (p13; q22) [17], is found in approximately 25% of childhood B-lineage precursor ALL [18, 19]. Many studies suggest that the presence of ETV6–RUNX1 is associated with a favorable outcome [10, 20]. The ETV6–JAK2 fusion protein causes constitutive activation of JAK2 tyrosine kinase and promotes the survival and proliferation of cancerous cells in malignant disorders [21]. The ETV6–JAK2 fusion is rare and has been reported in only a few cases of lymphoid and myeloid leukemia [22, 23]. Dozens of cases have been reported with ETV6–ABL1, including acute myelogenous leukemia (AML), myeloproliferative neoplasm, and ALL, which are mostly characterized by eosinophilia [2426]. Highly analogous to ABL1, the ABL2 (ARG) gene encodes a non-tyrosine kinase protein that is involved in translocation with ETV6 [27]. The ETV6–ABL2 fusion was firstly reported in a patient with AML-M4 with eosinophilia (AML-M4Eo), which occurs rarely in leukemia [28, 29]. The nuclear receptor coactivator 2 (NCOA2) gene aids in the function of nuclear hormone receptors [30]. It was found to be fused with the ETV6 gene as ETV6–NCOA2 in six cases of childhood acute leukemia with a high frequency of NOTCH1-activating mutations and the coexpression of myeloid and T lymphoid antigens [31]. The PAX5-ETV6 fusion protein, firstly reported in an adult patient with ALL, is thought to block B cell differentiation in the early stage [32, 33]. The MNX1–ETV6 (HLXB9–TEL) fusion is most seen in the patients with infant AML whose presence often portends an extremely poor prognosis [34, 35]. The protein encoded by the SYK gene, which is widely expressed in hematopoietic cells, is a non-receptor tyrosine kinase. The ETV6–SYK fusion was reported in a case with myelodysplastic syndrome [36].

These ETV6 fusion genes have been mostly reported in pediatric patients, and little work has been done on the incidence and clinical significance of the eight ETV6 gene rearrangements in adult B-ALL and T-ALL. In this study, we sought to examine the incidence of ETV6 gene rearrangements in 176 B- and T-lineage ALL patients by multiplex-nested RT-PCR and further evaluated the therapeutic outcomes of B- and T-lineage ALL patients who were positive for ETV6 gene rearrangements.

Patients and methods

Patients and samples

Bone marrow samples were collected from 176 ALL patients who received treatment at the Department of Hematology, the PLA General Hospital, Beijing, China, between January 2007 and July 2011. Written informed consent was obtained from all the patients or their legal surrogates. The study protocol was approved by the institutional review board of the PLA General Hospital. Diagnosis of ALL was made according to the standard morphological and immunophenotyping criteria. All patients underwent conventional induction chemotherapy with vincristine, prednisone, daunorubicin, and L-asparaginase. Intensified consolidation and maintenance therapy or hematopoietic stem cell transplantation (HSCT) was introduced after hematological complete remission (CR) had been achieved.

Flow cytometry

Immunophenotyping was performed by flow cytometry using monoclonal antibodies against CD45, HLA-DR, CD34, CD19, CD10, cIgM, sIgM, CD7, CD2, CD5, CD3, CD13 CD14, CD41, CD56, CD22, CD79a, TdT, CD8, and CD33.

Karyotype analysis and FISH assay

Cytogenetic analysis of bone marrow blast cells was performed using a direct method or short-term unstimulated cultures. Metaphase chromosomes were karyotyped according to the International System for Human Cytogenetic Nomenclature. Fluorescence in situ hybridization (FISH) analyses were carried out for detection of ETV6 fusion genes in 46 patients.

RNA isolation, reverse transcription, and multiplex-nested PCR

RNA was extracted from the bone borrow and reverse transcribed to cDNA as previously described [37]. Reverse transcription and multiplex-nested PCR were carried out on Veriti® Thermal Cycler (Applied Biosystems, USA). The primers for the detection of ETV6-associated fusion genes in the multiplex-nested PCR are listed in Table 1. To verify the integrity of the isolated RNA and correct synthesis of cDNA, we co-amplified GAPDH mRNA as an internal positive control. The multiplex-nested PCR was run in a 25-μL volume under the cycling conditions listed in Table 2. The PCR products were resolved on 2% agarose gels and visualized with ethidium bromide. Every sample was further confirmed by individual (split-out) PCR using specific primers for each transcript under identical cycling conditions to those of the multiplex-nested PCR, and DNA sequencing was employed in part of them.
Table 1

PCR primers of fusion genes with ETV6 rearrangement

Fusion genes

Primers(5′-3′)

For the first cycle PCR

For the second cycle PCR

ETV6–RUNX1

F1 CCACCCGAAGCCATCCA

F2 GCACTCCGTGGATTTCAAACA

R1 CAACGCCTCGCTCATCTTG

R2 GCTCAGCGCGGTGGAA

ETV6–JAK2

F1 CCTCGGATTCTTTTTTCACCAT

F2 AGCCGGAGGTCATACTGCAT

R1 TGCTAATTCTGCCCACTTTGG

R2 CCACTGCAGATTTCCCACAA

ETV6–ABL1

F1 AGCAGAGGAAACCTCGGATTC

F2 CTCTCCTGCTGCTGACCAAAG

R1 TATAGCCTAAGACCCGGAGCTTTT

R2 CAACGAGCGGCTTCACTCA

ETV6–ABL2

F1 CCACCCGAAGCCATCCA

F2 GCACTCCGTGGATTTCAAACA

R1 CTCGTAGCTTTTCACCTTTAGTGATG

R2 AGCTCCACCTGATAGCCTCATT

ETV6–NCOA2

F1 CCACCCGAAGCCATCCA

F2 GCACTCCGTGGATTTCAAACA

R1 TGCCCCATGGCCTGAAAG

R2 ATTAGAGATGAACATGG

PAX5–ETV6

F1 CCACCCGAAGCCATCCA

F2 GCACTCCGTGGATTTCAAACA

R1 TGCAGCCAATTTACTGGAG

R2 AGCGCTCAGGATGGAGGAAG

MNX1–ETV6

F1 CACCTTCCAGCTGGACCAG

F2 GGCATGATCCTGCCTAAG

R1 TGCAGCCAATTTACTGGAG

R2 TGCAGCCAATTTACTGGAG

ETV6–SYK

F1 CCACCCGAAGCCATCCA

F2 GCACTCCGTGGATTTCAAACA

R1 GGATAGTCTTCGCTCTTCATGAACA

R2 GTACTTGAGCCAGCTTCCAACA

Table 2

Cycling conditions for multiplex-nested PCR

 

The first cycle PCR conditions

The second cycle PCR conditions

Initial PCR activation

5 min

95°C

5 min

95°C

3-step cycling

 Denaturation

30 s

95°C

30 s

95°C

 Annealing

50 s

58°C

50 s

58°C

 Extension

60 s

72°C

60 s

72°C

 No. of cycles

25

30

  

 Final extension

10 min

72°C

10 min

72°C

Quantification of ETV6-associated fusion gene transcripts by real-time PCR

We also performed real-time PCR to quantify ETV6-associated fusion gene transcripts in positive samples at different time points. The primers and probes are listed in Table 3. Each quantitative RT-PCR was carried out in a 20-μL volume with TaqMan universal master mix (Applied Biosystems, USA), 0.25 μM appropriate primers and probes, and 20 ng cDNA. The PCR was run for 40 cycles of denaturation for 15 s at 95°C and annealing for 60 s at 60°C. A standard curve was produced for ETV6 fusion genes by tenfold serial dilutions of six different plasmid concentrations. The standard curve was saved in a standard curve file. In all the RT-PCR assays, a reference dilution was analyzed and the standard curve was loaded over this reference sample.
Table 3

PCR primers and probes for detection of ETV6 fusion genes

No.

Fusion genes

5′-3′

Primer

Probe

1

ETV6–RUNX1

F CCTGGCTTACATGAACCACATC

P TGGTCTCTGTCTCCC

R GGCATCGTGGACGTCTCTAGA

2

ETV6–JAK2

F TCCACCCTGGAAACTCTATACACA

P CAGCCGGAGGTCAT

R TGGCACATACATTCCCATGAA

3

ETV6–ABL1

F AGCCGGAGGTCATACTGCAT

P ATGAAGAAGAAGCCCTTC

R GAAGGTTTTCCTTGGAGTTCCA

4

ETV6–ABL2

F CTCTGTCTCCCCGCCTGAA

P CCCATTGGGAGAATAG

R TCCAGTCTTGTCTCCCTCAAATC

5

ETV6–NCOA2

F TCAGCATATTCTGAAGCAGAGGAA

P CCTCGGATTCTTTTTTCACCA

R GAGGTCCCCCCATGTTCATC

6

PAX5–ETV6

F CAGTCCCAGCTTCCAGTCACA

P TGCAGCCAATTTACT

R TGTTGCTGTCAATTGGCCTTAA

7

MNX1–ETV6

F CCGACTTCAACTCAGGAACGA

P ATATACACCTCCAGAGAGC

R GCAGGCGGATCGAGTCTTC

8

ETV6–SYK

F TGCCCATTGGGAGAATAGCA

P AAATGTTAATTTTGGAGGCCGT

R CCAGGCTTTGGGAAGGAGTAT

Results

Multiplex-nested PCR detection of ETV6 fusion gene transcripts in ALL patients

One hundred seventy-six ALL patients were included in the study. They included 112 male and 64 female patients. Their mean age was 41.4 years (range, 14–83 years). One hundred thirty-six patients had B-lineage ALL and 40 patients had T-lineage ALL. The demographic and disease characteristics of these patients are listed in Table 4. Our multiplex-nested RT-PCR assays detected the presence of ETV6 gene rearrangements in 15 ALL patients involving seven different ETV6-associated fusion genes including ETV6–RUNX1, ETV6–JAK2, ETV6–ABL1, ETV6–ABL2, ETV6–NCOA2, ETV6–SYK, and PAX5–ETV6 (Fig. 1) and the positive rate was 8.5%. Thirteen B-lineage ALL patients (13/136, 9.6%) had ETV6 fusions, while two T-lineage ALL patients (2/40, 5.0%) exhibited ETV6 fusions. Among the fusion genes, ETV6–RUNX1 was seen in six cases (3.4%), ETV6–JAK2 in three cases (1.7%), ETV6–ABL1 in two cases (1.1%), and ETV6–ABL2, ETV6–NCOA2, ETV6–SYK, and PAX5–ETV6 each in one case (0.6%). All six patients with ETV6–RUNX1 had B-ALL. Two of the three patients with ETV6–JAK2 had B-ALL and the remaining patient had T-ALL. One patient with ETV6–NCOA2 had T-ALL. Two patients with ETV6–ABL1and one with ETV6–ABL2 had B-ALL. One patient with the PAX5–ETV6 fusion gene and one patient with ETV6–SYK had B-ALL. All positive ALL samples were confirmed by karyotype analysis, FISH, or sequencing.
Table 4

Demographic and disease characteristics of the patient population (n = 176)

Mean age, years (range)

41.4 (14–83)

Gender

M, 112/F, 64

B-ALL

n = 136

T-ALL

n = 40

Median WBC, ×109/L (range)

16.6 (3–51.4)

Median platelet count,×109/L (range)

72 (11–564)

Median hemoglobin, g/dL (range)

9.2 (4–15)

Aberrant karyotypes

61

 11q23 abnormalities

9

 t(1;19)(q23;p13)

5

 t(9;22)(q34;q11)

23

 t(8;14)(q24;q11)

1

 t(1;14)(q24;q11)

2

 9p abnormality

2

 Complex karyotype

19

CD2 +/−

10/109

CD3 +/−

12/107

CD5 +/−

15/104

CD10 +/−

63/82

CD19 +/−

65/80

CD34 +/−

48/97

CD45 +/−

42/43

CD56 +/−

56/42

ALL acute lymphoblastic leukemia, WBC white blood cells

https://static-content.springer.com/image/art%3A10.1007%2Fs00277-012-1431-4/MediaObjects/277_2012_1431_Fig1_HTML.gif
Fig. 1

Amplification of ETV6 fusion gene fragments by multiplex-nested RT-PCR in 15 patients with acute lymphoblastic leukemia. Lanes 1, 5, 14: ETV6–JAK2; lane 2: ETV6–ABL2; lanes 3, 4, 6, 10, 11, 15: ETV6–RUNX1; lanes 7, 8: ETV6–ABL1; lane 9: ETV6–NCOA2; lane 12: ETV6–SYK; lane 13: PAX5–ETV6

Therapeutic response of ALL patients expressing the ETV6 fusion genes

We further analyzed the therapeutic response of patients expressing the ETV6 fusion genes. The karyotype and therapeutic response of these patients are listed in Table 5. All the six patients with ETV6–RUNX1 (6/6, 100%) achieved hematological CR after one cycle of standard chemotherapy. Only one patient with ETV6–RUNX1 underwent allogeneic HSCT (allo-HSCT) as a result of harboring P53 mutation and complex karyotype, which predict progression and poor outcome. Three patients with ETV6–JAK2 and two with ETV6–ABL1 did not achieve CR after one cycle of standard chemotherapy, and two patients with ETV6–JAK2 and one patient with ETV6–ABL1 underwent HSCT. One patient with ETV6–ABL2 and one patient with ETV6–SYK did not achieve CR after one cycle of standard chemotherapy and did not receive HSCT. One patient with ETV6–NCOA2 achieved CR after one cycle of standard chemotherapy and finally received allo-HSCT.
Table 5

Karyotype and therapeutic response of 15 acute lymphoblastic leukemia (ALL) patients with ETV6-associated fusion genes

Patient No.

Gender/age (years)

Diagnosis

Fusion gene

Karyotype

Hematological CR

Molecular CR

HSCT

1

M/32

B-ALL

ETV6–JAK2

47,XY,t(9;12)(p24;p13),+8,−17,+22[6]/46,XY,−17,+22[5]/46,XY[10]

No

No

Yesa

2

M/23

T-ALL

ETV6–NCOA2

46,XY,t(8;12)(q13;p13),−4,+9[4]

Yes

Yes

Yesa

3

F/28

B-ALL

ETV6–RUNX1

46,XX[20]

Yes

Yes

No

4

M/33

B-ALL

ETV6–RUNX1

46,XY,del(5)(q23q32)[4]/46,XY[16]

Yes

Yes

No

5

M/42

B-ALL

ETV6–JAK2

46,XY,t(9;12)(p24;p13) [10]

No

No

No

6

F/40

B-ALL

ETV6–RUNX1

47,XX,+8?[2]/46,XX[18]

Yes

Yes

No

7

M/58

B-ALL

ETV6–ABL1

46,XY,t(9;12)(q34;p13)[2]/45,XY,−2,−14,+17[2] /46,XY[16]

No

No

No

8

F/49

B-ALL

ETV6–ABL1

46,XX,t(9;12)(q34;p13) [20]

No

No

Yesa

9

M/17

B-ALL

ETV6–ABL2

45,XY,t(1;12)(q25;p13),-1,-5,+11[2]/46,XY,t(1;12)(q25;p13),-1,+11[3]/46,XY[15]

No

No

No

10

M/14

B-ALL

ETV6–RUNX1

46,XY,del(9)(q22)[10]/46,XY[10]

Yes

Yes

No

11

M/16

B-ALL

ETV6–RUNX1

46,XY,del(7)(q13q34)[4]/47XY,-3,-4,+8,+10,+14[3]/46,XY[13]

Yes

Yes

Yesa

12

M/43

B-ALL

PAX5–ETV6

45,XY,−21[1]/46,XX,[19]

No

No

No

13

M/67

B-ALL

ETV6–SYK

45,XY,t(9;12)(q22;p13),1q+,−6[6]/46,XY[14]

No

No

No

14

F/25

T-ALL

ETV6–JAK2

46,XX,t(9;12)(p24;p13) [12]/46,XX[8]

No

No

Yesb

15

M/22

B-ALL

ETV6–RUNX1

46,XY,add(15)(p11)[11]

Yes

Yes

No

CR complete remission, HSCT hematological stem cell transplantation

aAllo-PBSCT (peripheral blood stem cell transplantation)

bAuto-PBSCT

ETV6-associated fusion gene transcript levels at presentation and follow-up

We examined the mRNA transcript levels of the ETV6 fusion genes in the 15 ALL patients (Fig. 2). Our RT-PCR assays revealed that, at diagnosis, the ratio of ETV6 fusion genes/GAPDH ranged between 33.9% and 101.3% with a median of 67.3%. The ETV6–RUNX1 mRNA transcript levels were further detected at different time points in six patients (patient nos. 3, 4, 6, 10, 11, and 15). We found that the ETV6–RUNX1 mRNA transcript levels decreased during conventional chemotherapy or HSCT. The mRNA levels decreased sharply after one cycle of chemotherapy, along with hematological CR in the bone marrow. Patient no. 11 underwent HSCT after three cycles of chemotherapy, and after 12 months, the ETV6–RUNX1 mRNA transcript levels were reduced to 0 copies. However, patients harboring ETV6–JAK2, ETV6–ABL2, ETV6–ABL1, ETV6–SYK, or PAX5–ETV6 did not achieve CR in bone marrow after one cycle of chemotherapy, and ETV6 fusion gene mRNA transcript levels increased gradually after 3 to 6 months although experiencing a brief but transient decline. Among these patients, patient nos. 1, 8, and 14 underwent HSCT, while patient nos. 7, 9, 12, and 13 abandoned therapy due to severe pulmonary infection and economic difficulty. The patient with ETV6–NCOA2 carrying NOCTCH1 mutation was treated with HSCT after achieving CR, and the mRNA transcript levels tapered to very low copies after 12 months (4 months after HSCT).
https://static-content.springer.com/image/art%3A10.1007%2Fs00277-012-1431-4/MediaObjects/277_2012_1431_Fig2_HTML.gif
Fig. 2

ETV6 fusion gene mRNA transcript levels in blasts in bone marrow in 15 patients with acute lymphoblastic leukemia. The X-axis represents the follow-up duration (in months) and the Y-axis represents the ETV6 fusion gene mRNA transcripts/GAPDH (in percent). a Relative expression of ETV6–RUNX1 mRNA transcripts in six patients; b relative expression of ETV6–JAK2 mRNA transcripts in three patients; c relative expression of ETV6–ABL1 mRNA transcripts in two patients; d relative expression of other ETV6 fusion gene mRNA transcripts in four patients

Discussion

Over the past decade, due to improved diagnosis and treatment, the prognosis of ALL patients has been greatly enhanced [1]. Identification of specific chromosomal abnormalities is an important approach for diagnosis and risk stratification of ALL, which has helped to improve the survival rate of ALL patients to 80% in some studies [38]. Therefore, the detection of fusion genes resultant from chromosomal translocations plays a major role in the diagnosis, treatment, prognosis, and monitoring of minimal residual disease in ALL patients. Multiplex-nested RT-PCR can amplify different loci of DNA template with two or more specific primers in the same reaction and can detect minimal residual disease at very low levels (<0.01%) in leukemia patients. Therefore, the method could be used to generate useful data that serve as valuable guidance for individualized treatment [39, 40]. In this study, we employed multiplex-nested RT-PCR assays and detected seven ETV6 fusion genes in bone marrow samples from 176 newly diagnosed adult ALL patients.

ETV6–RUNX1 is the most common fusion gene and is found in 20% to 25% of childhood ALL. However, it is rare in adult ALL, occurring only in 3% to 6% of adult ALL patients [41, 42]. It has been reported that ALL patients with the ETV6–RUNX1 fusion gene are associated with a relatively favorable clinical outcome and lower recurrence rate. In our study, the positive rate of ETV6–RUNX1 was 3.4%, which is consistent with that previously reported [43]. We further monitored the changes in the quantities of the ETV6 gene transcripts by real-time quantitative PCR and we found that the ETV6–RUNX1 mRNA transcript levels sharply decreased in response to standard antitumor regimens, and after several cycles of chemotherapy or HSCT, the mRNA transcripts became undetectable. ALL patients with the other seven types of ETV6-associated fusion genes often have poor clinical outcomes [44, 45]. ETV6–JAK2, which has been systematically studied over the recent years, occurs as a result of translocation of chromosome 9 and chromosome 12. The putative involvement of the ETV6–JAK2 fusion gene in both myeloid and lymphoid malignancies is unusual and the prognostic value has been investigated by several research groups. This fusion gene was detected in two B-ALL patients and one T-ALL patients in our study, and the positive rate of ETV6–JAK2 was 1.7%, suggesting that it is rare in ALL patients. ETV6–ABL1 is involved in ALL, AML, and the blast crisis of chronic myeloid leukemia and is rare in myelodysplastic syndrome [25, 46]. The fusion gene was detected in two of our patients, and the frequency was 1.1%. In addition, three patients with the ETV6–JAK2 fusion gene and two patients with the ETV6–ABL1 fusion gene did not achieve CR, indicating that patients with the two fusion genes may have a poor response to chemotherapy and need more aggressive therapy. Other ETV6 gene fusions including ETV6–SYK, ETV6–NCOA2, ETV6–ABL2, and PAX5–ETV6 were extremely rare in ALL patients in this work, which is consistent with that of previous reports [47, 48]. The patient with ETV6–NCOA2 was diagnosed with T-ALL, consistent with a previous report that the ETV6–NCOA2 fusion gene is often associated with T cell-related malignancy [31], achieving hematological CR in bone marrow after one cycle of chemotherapy. However, patients with ETV6 fusions including ETV6–SYK, ETV6–ABL2, and PAX5–ETV6 showed no evident chance for a favorable response to traditional chemotherapy.

In this report, three patients had the ETV6–JAK2 fusion gene, and two of them were diagnosed with B-ALL and one with T-ALL. They exhibited no favorable response to standard antitumor therapy, and the fusion gene mRNA transcript levels continued to increase after two or three cycle of chemotherapy although with a short but transient decline during the treatment. Among the three patients, the patient with T-ALL was still alive after allogeneic peripheral blood stem cell transplantation (allo-PBSCT), while the other two patients relapsed. It is intriguing that the patient with the ETV6–NCOA2 fusion gene in this study seemed to respond favorably to traditional chemotherapy, along with an apparent decline in the gene mRNA transcript levels, which tapered to very low copies after 4 months of PBSCT. However, patients with ETV6–ABL1, ETV6–ABL2, ETV6–SYK, and PAX5–ETV6 apparently failed to achieve hematological CR.

In summary, our study further shows that multiplex-nested RT-PCR can rapidly and accurately detect several ETV6-associated fusion genes simultaneously, providing some clues for the diagnosis and prognosis of adult ALL. It is worthy of being applied in clinical practice and can complement cytogenetic study. In further studies, multiplex-nested RT-PCR can be used in a larger number of ALL patients to detect a wider range of ETV6-associated fusion gene. The incidence of different fusion genes and their significances of diagnosis and prognosis in ALL patients can be studied in more detail.

Acknowledgments

This work was supported by grants from the National Basic Research Program of China (2005CB522400), National Natural Science Foundation of China (90919044, 30971297,81000221, and 81170518), High and New Technology Program of PLA (2010gxjs091), and Capital Medical Development Scientific Research Fund (no. 2007-2040). We thank Jing-fen Sun and Li-ye Fu for discussion and technical assistance.

Conflicts of interests

The authors declare that they have no competing interests.

Copyright information

© Springer-Verlag 2012