Applied Microbiology and Biotechnology

, Volume 85, Issue 6, pp 1831–1838

Cholesterol oxidase ChoL is a critical enzyme that catalyzes the conversion of diosgenin to 4-ene-3-keto steroids in Streptomyces virginiae IBL-14

Authors

  • Bo Li
    • State Key Laboratory of Bioreactor Engineering, Newworld Institute of BiotechnologyEast China University of Science and Technology
  • Wei Wang
    • State Key Laboratory of Bioreactor Engineering, Newworld Institute of BiotechnologyEast China University of Science and Technology
    • State Key Laboratory of Bioreactor Engineering, Newworld Institute of BiotechnologyEast China University of Science and Technology
    • East China University of Science and Technology
    • State Key Laboratory of Bioreactor Engineering, Newworld Institute of BiotechnologyEast China University of Science and Technology
    • East China University of Science and Technology
Biotechnologically Relevant Enzymes and Proteins

DOI: 10.1007/s00253-009-2188-0

Cite this article as:
Li, B., Wang, W., Wang, F. et al. Appl Microbiol Biotechnol (2010) 85: 1831. doi:10.1007/s00253-009-2188-0

Abstract

Diosgenin transformation was studied in Streptomyces virginiae IBL-14, a soil-dwelling bacterium with diosgenin-degrading capacity. All of the derivatives isolated were identified as 4-ene-3-keto steroids. We cloned ChoL, a fragment of a cholesterol oxidase from S. virginiae IBL-14, and used gene-disruption techniques to determine its function in the oxidation of diosgenin to 4-ene-3-keto steroids. Subsequently, the entire open reading frame of ChoL was cloned by chromosome walking, and the His6-tagged recombinant protein was overproduced, purified, and characterized. ChoL consisted of 1,629 nucleotides that encoded a protein of 542 amino acids, including a 34-residue putative signal peptide at the N-terminal. ChoL showed 85% amino acid similarity to ChoA from Streptomyces sp. SA-COO. This enzyme can also oxidize other steroids such as cholesterol, sitosterol, and dehydroepiandrosterone, which showed higher affinity (Km = 0.195 mM) to diosgenin. The catalytic properties of this enzyme indicate that it may be useful in diosgenin transformation, degradation, and assay.

Keywords

Cholesterol oxidaseStreptomyces virginiae IBL-14DiosgeninDiosgenone4-ene-3-keto steroids

Introduction

Cholesterol oxidase (Cho) is a FAD-dependent enzyme that catalyzes the oxidation and isomerization of cholesterol (5-cholesten-3-β-ol) to 4-cholesten-3-one (cholestenone) and H2O2 (MacLachlan et al. 2000). This is the initial reaction in the microbial degradation of cholesterol and certain other natural sterols (MacLachlan et al. 2000). Due to its specific oxidative functions with respect to sterols, Cho has been used to quantify cholesterol, plant sterols, and stanols in clinical and food specimens (Moreau et al. 2003). Recently, a Cho was identified in a Streptomyces strain as being a signal protein in antifungal antibiotic biosynthesis. It was speculated to act as a fungal sensor by detecting ergosterol (Aparicio and Martin 2008).

Diosgenin [(25R)-spirost-5-en-3β-ol], a naturally occurring steroidal sapogenin, is one of the most important raw materials in the preparation of steroidal pharmaceuticals such as cortisones and sex hormones (Laveaga 2005). In our recent studies (Wang et al. 2007, 2009a, b), we examined the metabolism of diosgenin in a soil-dwelling bacterium Streptomyces virginiae IBL-14. This microorganism was isolated from wastewater pools of steroid pharmaceutical plants for its diosgenin-degrading capacity. All derivatives of diosgenin metabolized by S. virginiae IBL-14 have been identified as 4-ene-3-keto steroids. It was speculated that Cho was involved in the transformation of diosgenin to 4-ene-3-keto steroids and that the process occurred through the typical reaction pathways of cholesterol oxidases.

In this paper, we present the importance of Cho in the metabolism of diosgenin in S. virginiae IBL-14. To obtain a Cho that had the required properties, we first prepared a partial gene named choL by homology analysis and then disrupted it by single-crossover inactivation to analyze its role in diosgenin degradation. To verify the functions of choL, the entire ORF was cloned by chromosome walking and expressed in Escherichia coli BL21(DE3)plysS. The catalytic properties of ChoL were studied after purification.

Materials and methods

Materials, strains, and plasmids

The chemicals used were the same as those reported earlier (Wang et al. 2007). E. coli DH5α was used as the host for plasmid construction. S. virginiae IBL-14 (CCTCCM206045) was deposited in the China Center for Type Culture collection (CCTCC, http://www.cctcc.org/), Wuhan, China. E. coli ET12567 (Sekurova et al. 1999) was used for DNA demethylation. The vector pMD19-T (TaKaRa, Japan) was used for TA cloning. The shuttle plasmid pKC1139 (Bierman et al. 1992) was used to disrupt S. virginiae IBL-14 choL by single-crossover recombination. The bacterial strains and plasmids used in this study are listed in Table 1.
Table 1

Microorganisms and plasmids used in the study

Strains or plasmids

Relevant propertiesa

Source or reference

Escherichia coli strains

 DH5α

General cloning host

BRL

 ET12567(pUZ8002)

Strain for intergeneric conjugation; Kmr, Cmr, Strr, Tetr

11

 BL21(DE3) plysS

  

Streptomyces virginiae strains

 IBL-14

Wild type

 

 S-choL

IBL-14 derivative; ΔchoL

This study

Plasmids

 pMD19-T

TA clone

TaKaRa

 pKC1139

Apr; an E. coli replicon and a thermosensitive Streptomyces replicon

3

 pKC1139-choL::kan

Partial fragment of choL and the kanamycin-resistance gene were digested with HindIII/BglII and BglII/EcoRI, respectively, and ligated into the HindIII and EcoRI sites of pKC1139

This study

 pET22-choL

HindIII/XhoI fragment of choL into HindIII/XhoI-cut pET22

This study

Media

The processes for cultivating S. virginiae IBL-14 have been described previously (Wang et al. 2007). Luria-Bertani (LB) medium was used for plasmid construction and protein expression. If required, the medium was supplemented with ampicillin, kanamycin, apramycin, or chloramphenicol.

Cloning of a partial sequence of choL

The degenerate primers Lf and Lr (Table 2) were synthesized based on the sequences of various Cho genes such as choA (Genbank P12676) from Streptomyces sp. SA-COO (Murooka et al. 1986), choM (Genbank U13981) from Streptomyces sp. A19249, and partial genomic DNA (Genbank NC_003155.4) from Streptomyces avermitilis MA-4680 (Aparicio et al. 2000). Polymerase chain reaction (PCR) was performed with the LA Taq polymerase (TaKaRa, Japan) using the genomic DNA of S. virginiae IBL-14 as the template. A 571-bp choL gene fragment was amplified.
Table 2

Primers used in the study

Primers used

Primers for the partial sequence of choL

 Lf

CCTGATGCTGGAGATGGG

 Lr

GACCTTGCCGTGGTTGTT

Primers for choL disruption

 LDf

CCTGAAAGCTTCCTGATGCTGGAGATGGG

HindIII

 LDr

GACCTAGATCTGACCTTGCCGTGGTTGTT

BglII

Primers for sequence of the kanamycin-resistance gene

 Kf

GAACAGATCTTGGCCTAACTACGGCTACAC

BglII

 Kr

TTGAGAATTCTGATGGTTCACGTAGTGGGC

EcoRI

Primers for genome walking

 Lwf01

GCCTCGGTGCGGTTCTTGAACCAGCTGGAG

 Lwf02

TTCCACAGCTGGCCCATCTCCAGCATCAGG

 Lwr01

GGCACCGTACACGTCCCCAACGTCTACGAC

 Lwr02

GTCATCTACGGCAACAACCACGGCAAGGTC

 CP01

GTACATATTGTCGTTAGAACGCGTAATACGACTCA

 CP02

CGTTAGAACGCGTAATACGACTCACTATAGGGAGA

Genome walking cassette

 Sau3AI cassette

  5′-OH-GTACATATTGTCGTTAAACCGTAATACACTCACTATAGGGA-3′

  3′-GATCTCCCTATAGTGAGTCGTATTACGCGTTCTAACGACAATATGTAC-OH-5′

 Sau3AI cassette

  5′-OH-GTACATATTGTCGTTAAACCGTAATACACTCACTATAGGGA-3′

  3′-GATCTCCCTATAGTGAGTCGTATTACGCGTTCTAACGACAATATGTAC-OH-5′

 HindIII cassette

  5′-OH-GTAATATTGTCGTTAGAACGCGTAATACGACTCACTATAGGGAGA-3′

  3′-AGCTTCTCCCTATAGTGAGTCGTATTACCGTTCTAACGACAATATGTAC-OH-5′

 EcoRI cassette

  5′-OH-GTACATATTGTCGTTAGAACCGTAATACGACTCACTATAGGGAGAG-3′

  3′-AATTCTCTCCCTATAGTGAGTCGTATTACGCGTTCTAACGACAATATGTAC-OH-5′

 PstI cassette

  5′-OH-GTACATATTGTCGTTAGAACCGTAATACGACTCACTATAGGGAGACTGCA-3′

  3′-GTCTCCCTATAGTGAGTCGTATTACGCGTTCTAACACAATATGTAC-OH-5′

 Primers for choL

  choLf01

GCCAAGCTTGTGGAACAGCACCTGTCAC

HindIII

  choLr01

CCGCTCGAGCTACGCGGCGGTGACGTCCT

XhoI

Lf and Lr were used to amplify the partial sequence of choL; primers Lwf01, Lwf02, Lwr01, and Lwr02 were used to amplify the upstream and downstream sequences of choL respectively; primers CP01 and CP02 were universal primers that could be annealed with the genome walking cassette (GWC); the Sau3AI, HindIII, and EcoRI cassettes were genome walking cassettes consisting of two complementary oligonucleotide chains, a hydroxylated 5′ end, and the corresponding restriction enzyme sites (Sau3AI, HindIII, EcoRI, and PstI). These could be ligated to the genomic DNA digested with the corresponding restriction enzyme to construct the genome walking library; primers choLf01 and choLr01 were used to amplify the full-length choL gene with the HindIII and XhoI restriction sites

Gene disruption

The choL gene was inactivated by gene disruption via single-crossover recombination. For this purpose, a 571-bp fragment of choL was cloned using primers LDf and LDr (Table 2). The kanamycin-resistance gene, employed as a screening label, was also amplified from plasmid pET32 using primers Kf and Kr (Table 2). The sequences of the partial fragment of choL and kanamycin-resistance gene were then digested with HindIII/BglII and BglII/EcoRI, respectively, and ligated into the HindIII and EcoRI sites of pKC1139 to create pKC1139-choL::kan. The pKC1139-based temperature-sensitive plasmid pKC1139-choL::kan was amplified in E. coli ET12567 for demethylation and then transformed into S. virginiae IBL-14 using previously reported methods (Yamamoto et al. 1986).

The single-crossover event resulted in the tandem duplication of truncated choL genes with a vector containing an apramycin and a kanamycin-resistance gene between the sequences. The mutants were selected at 39°C (Yamamoto et al. 1986). PCR reactions were carried out using mutant genomic DNA as the template with the primers LDf and Kr (Table 2).

Genome walking

To obtain the entire ORF of ChoL, four gene special primers (Lwf01, Lwf02, Lwr01, and Lwr02; Table 2) were designed to perform genome walking PCR (Elalami et al. 1999). The primers CP01 and CP02 (Table 2) could be annealed to the genome walking cassette (GWC). After digestion with the restriction enzymes Sau3AI, HindIII, EcoRI, and PstI, the IBL-14 genomic DNA fragments were ligated with the GWC to construct genome walking libraries. Two-step and nested PCR were performed (Elalami et al. 1999). Finally, the nested PCR products were cloned into the pMD19-T vector and sequenced.

Construction of the expression plasmid

Primers choLf01 and choLr01 (Table 2) were designed on the basis of sequences obtained from genome walking PCR to amplify the entire ORF of ChoL. The PCR products were digested with HindIII/XhoI and subsequently cloned into the expression vector pET-22b(+) that had been previously digested with HindIII/XhoI (creating pET22-choL). This generated a C-terminal His6-tagged ChoL construct that was subjected to further biochemical characterization. The construct (pET22-choL) was then transformed into E. coli BL21(DE3) plysS cells.

Expression, purification, and analysis of recombinant ChoL

To express ChoL, 500 ml LB (containing 100 μg/ml ampicillin) was inoculated with 10 ml of the overnight culture in the same medium at 37°C at a shaker speed of 200 rpm. When the optical density at 600 nm reached a value of 0.5–0.6, IPTG was added to a final concentration of 0.075 mM, and the cells were grown for another 24 h at 24°C. The cells were collected by centrifugation (4,000×g) for 10 min at 4°C, resuspended in 50 ml buffer A (20 mM phosphate buffer (pH 8.0), 500 mM NaCl, and 50 mM imidazole), and lysed by sonication for 10 min in an ice-water bath. The cell lysate was centrifuged at 10,000×g for 20 min, and the supernatant was filtered through 0.45-μm membranes. It was then applied to a 15-ml Ni2+-chelating Sepharose Fast Flow column (Amersham Biosciences) that had been pre-equilibrated with buffer A. After washing to baseline, the protein was eluted with buffer B (20 mM phosphate buffer (pH 8.0), 500 mM NaCl, and 200 mM imidazole). Fractions containing recombinant ChoL were applied to a 5-ml Hitrap Desalting column (Amersham Biosciences) to remove the salts from the protein, according to the manufacturer’s instructions.

Characterization of recombinant ChoL

ChoL activity was assayed by measuring H2O2, which is known to be formed stoichiometrically when cholesterol and other 3-β-hydroxysteroids are oxidized (Richmond 1973). The assay mixture contained 3 ml solution A (1 mmol/l 4-aminoantipyrine, 6 mmol/l phenol, 0.2 g/l sodium azide, 5,000 U/l horseradish peroxidase, and 25 mmol/l phosphate buffer (pH 7.5)) and 150 μl isopropanol solution B (8.26 g/l cholesterol and 4.26% Triton X-100). The assay mixture was incubated with Cho at 37°C for 5 min and then placed in a boiling water bath for 5 min. The development of a red color was monitored at 500 nm. One unit of enzyme activity was defined as the amount of enzyme required to oxidize 1 μmol of cholesterol at 37°C per minute.

To investigate the optimum pH for ChoL activity, the Britton–Robinson buffer system was used, which had a buffering range from pH 2.0 to 12.0. The substrate was 20 mM cholesterol. The pH value at which the highest enzyme activity was observed was regarded to be the optimal pH. The optimum temperature for ChoL activity was determined in the temperature range 20°C to 70°C. The thermal stability was measured by assessing the residual enzyme activity after incubation at 30°C, 40°C, 45°C, 50°C, and 60°C for 6 h.

The specificity toward different substrates was kinetically analyzed in a cuvette system maintained at pH 7.5 and 45°C using the enzyme assay method mentioned above (at varying substrates concentrations, 0.1–1 mM) and 50 μg of ChoL. The Michaelis constant (Km) of ChoL was determined by the Lineweaver–Burk method.

Analytical methods

Diosgenin metabolism in S. virginiae IBL-14 was analyzed by high-performance liquid chromatography (HPLC) and liquid chromatography–mass spectrometry, as reported previously (Wang et al. 2007).

Accession numbers

The choL gene sequence and ChoL amino acid sequence from S. virginiae IBL-14 have been deposited in the GenBank database under the accession numbers EU013931 and ABS32193, respectively.

Results

Cloning of the genetic determinant responsible for the oxidation of diosgenin to diosgenone from S. virginiae IBL-14

Two major metabolites, i.e., diosgenone and isonuatigenone, and nine minor metabolites (Wang et al. 2007, 2009a, b) have been isolated from diosgenin catabolism in S. virginiae IBL-14. All of these were 4-ene-3-keto steroids. Two reactions are involved in the oxidation of diosgenin (spirost-5-en-3-ol) to diosgenone (spirost-4-en-3-one) and other 4-ene-3-keto steroids. These are the oxidation of a C3 alcohol to C3 ketone and the isomerization of 5-ene to 4-ene, which is speculated to be carried out by a Cho since it is well known that this enzyme catalyzes the conversion of cholesterol (chlolest-5-en-3β-ol) and phytosterols to 4-ene-3-keto steroids (MacLachlan et al. 2000). Based on this assumption, Cho should directly oxidize diosgenin to diosgenone and may be involved in the formation of other 4-ene-3-keto steroids.

To identify Cho in S. virginiae IBL-14, the degenerate primers Lf and Lr (Table 2) were designed on the basis of the sequences of highly conserved fragments of the Cho genes in Streptomyces. A 571-bp consensus DNA fragment was obtained. Sequence alignment by BLAST also showed that the deduced amino acid sequence had 86% identity to the corresponding amino acid sequence of ChoA (Genbank P12676) from Streptomyces sp. SA-COO. This confirmed that the nucleotide fragment obtained was a partial sequence of a Cho gene. This Cho from S. virginiae IBL-14 was designated as ChoL (gene choL).

To determine whether ChoL is involved in the oxidation of diosgenin in S. virginiae IBL-14, the enzyme was inactivated by single-crossover recombination. The 571-bp partial fragment of choL and a kanamycin-resistance cassette were ligated into pKC1139 to yield the gene-disrupted plasmid pKC1139-choL::kan, which expressed apramycin and kanamycin resistance in both E. coli and Streptomyces and was temperature-sensitive in Streptomyces. The plasmid pKC1139-choL::kan was transformed into the S. virginiae IBL-14 protoplast, and the transformants were selected with apramycin and kanamycin.

Two mutants were selected and incubated in YEME culture medium containing apramycin and kanamycin (30 and 50 μg/ml, respectively) at 39°C for 48 h. The plasmid pKC1139-choL::kan could not be isolated from these two mutants, indicating that the plasmid has been integrated into the chromosome. To confirm the exact disruption of choL, the choL gene and the combinant fragment of the choL::kan gene were analyzed by PCR using the chromosome of the mutants as templates. The mutants (designated S-choL) were positive for the choL::kan gene and negative for the choL gene in the PCR analysis, suggesting that accurate integration and disruption had occurred (data not shown).

In comparison to the wild-type strain, S-choL showed no catalytic activity for the oxidation of diosgenin to diosgenone and other 4-ene-3-keto steroids (Fig. 1a), which confirmed our speculation regarding the function of ChoL in S. virginiae IBL-14. Interestingly, S-choL showed almost no detectable transformation activity of diosgenin because no derivatives of diosgenin could be detected, and the added diosgenin was still present after incubation for 48 h, indicating that ChoL is critical for diosgenin metabolism in IBL-14 (Fig. 1a).
https://static-content.springer.com/image/art%3A10.1007%2Fs00253-009-2188-0/MediaObjects/253_2009_2188_Fig1_HTML.gif
Fig. 1

a HPLC analysis of diosgenone production in wild-type S. virginiae IBL-14 and the gene-disruption transformant (SchoL): (I) S. virginiae IBL-14 wild type; (II) S. virginiae gene disruptant (SchoL); and (III) control. b HPLC analysis of diosgenone production in E. coli BL21(DE3)/plysS transformed with pET22-choL: (I) S. virginiae IBL-14 wild type; (II) E. coli BL21(DE3)/plysS transformed with pET22-choL; and (III) E. coli BL21(DE3)/plysS transformed with pET-22b(+). The HPLC conditions are described in Materials and methods

Cloning and characterization of choL from IBL-14

To further characterize the ChoL, the complete ORF of choL was obtained by genome walking PCR. A 3,178-bp DNA fragment containing full-length choL (EF646280.1) was cloned and sequenced. Sequence analysis revealed the complete sequence of the choL ORF with GTG as the start codon and 70% G+C content. The choL gene consists of 1,629 nucleotides and encodes a deduced protein of 542 amino acids. As a rule, the deduced ORF of Cho often contains a signal peptide in its N-terminal which contains a central hydrophobic region and a more polar C-terminal region (Corbin et al. 1994; Elalami et al. 1999; Navas et al. 2001; Ishizaki et al. 1989). According to the prediction tool of signal peptides, SignalP 3.0 (http://www.cbs.dtu.dk/services/SignalP/) (Jannick et al. 2004), a predicted signal peptide of 34 amino acids was also deduced in the N-terminal of ChoL. In comparison with the signal peptide of ChoA, the predicted signal sequence also contains the typical positively charged amino acids such as His and Arg-Arg-Arg (Fig. 2). For the mature protein of ChoL, the consensus sequence for FAD binding, i.e., GxGxGxxxxAxxxxxxG (Hanukoglu and Gutfinger 1989), is located near the N-terminal end at amino acids 16–32 (Fig. 2). Interestingly, the third invariant Gly in the FAD-binding motif is substituted with Ala in ChoL and in previously published cholesterol oxidases from Streptomyces.
https://static-content.springer.com/image/art%3A10.1007%2Fs00253-009-2188-0/MediaObjects/253_2009_2188_Fig2_HTML.gif
Fig. 2

Alignment of ChoL with other cholesterol oxidases: ChoB, cholesterol oxidase from Brevibacterium sterolicum; ChoE, enzyme from Rhodococcus equi; and ChoA, cholesterol oxidase from Streptomyces sp. SA-COO. The numbers indicate the amino acid residues from the N terminus of the protein (signal sequences included). The consensus amino acid residues for FAD binding are shown in bold and are boxed (upper alignment). The invariant Glu, His, and Asn residues (E394, H480, and N518 in mature ChoL) that may be contributing to catalysis (see text) are also boxed (bottom alignments). The reaction from diosgenin to diosgenone catalyzed by ChoL is indicated at the bottom (Mendes et al. 2007)

The molecular weight of ChoL was estimated to be 58.9 kDa, and the pI value was calculated to be 8.52 by the ExPASy compute pI/Mw program algorithm. BLAST analysis showed that ChoL had the highest sequence identity (85%) with ChoA, a commercial Cho from Streptomyces sp. SA-COO. Alignment of ChoL with other commercial cholesterol oxidases such as ChoE from Rhodococcus equi (Navas et al. 2001) and ChoB from Brevibacterium sterolicum (Ohta et al. 1991) revealed identities of 57% and 58%, respectively.

Expression and purification of recombinant ChoL

The choL gene with its native signal sequence (Corbin et al. 1994) was inserted into pET-22b(+) to generate the expression plasmid pET22-choL, which was then transformed into E. coli BL21(DE3)plysS cells. The SDS-PAGE profile revealed the presence of an additional protein band with an estimated molecular mass of 59 kDa (Fig. S-2A of Supplementary materials). The molecular mass of this band was close to that of ChoL. Recombinant ChoL was further purified by Ni2+-chelating chromatography.

Characterization of the enzymatic activity of ChoL

To characterize the enzymatic activity of ChoL in the oxidation of diosgenin to diosgenone, purified recombinant ChoL was used. As expected, diosgenone was produced from diosgenin (Fig. 1b). Taken together with the results from the choL disruption experiments, ChoL appeared to be the enzyme responsible for the oxidation of diosgenin to diosgenone in S. virginiae IBL-14.

To examine the enzymatic activity of ChoL, cholesterol was chosen as the substrate. The total protein content of the cell lysate was 236 mg, and its activity was 54.4 U. After His-binding affinity chromatography, the total yield was 75% with a specific activity of 1.7 U/mg protein. Data analysis showed that the optimal reaction temperature for ChoL was 45°C, while the optimal pH was 7.5 (Fig. 3). ChoL retained more than 80% activity in the pH range 6.5–9.0 and temperature range 35–48°C. The pH and temperature characteristics of ChoL are similar to those of commercial cholesterol oxidases from Brevibacterium sterolicum and Streptomyces (MacLachlan et al. 2000).
https://static-content.springer.com/image/art%3A10.1007%2Fs00253-009-2188-0/MediaObjects/253_2009_2188_Fig3_HTML.gif
Fig. 3

Characteristics of recombinant ChoL. a Effect of pH on the Cho activity of recombinant ChoL. b Effect of temperature on the Cho activity of recombinant ChoL. c Temperature stability of recombinant ChoL. The experiments were performed in triplicate

The enzymatic stability of ChoL was examined by incubating the enzyme with cholesterol in 50 mM phosphate buffer (pH 7.5) at various temperatures for 6 h (Fig. 3c). The enzyme was stable below 40°C without obvious inactivation after 6 h of incubation. When the temperature exceeded 50°C, the ChoL activity rapidly decreased. The enzyme retained only approximately 40% of its initial activity after incubation for 6 h at 50°C and only 17% after incubation for 1 h at 60°C.

Four familiar 3β-hydroxysteroids were selected to test the activity of ChoL. The Km values were as follows: 0.195 mM for diosgenin; 0.524 mM, cholesterol; 0.591 mM, sitosterol; and 0.491 mM, dehydroepiandrosterone. Diosgenin was the best substrate.

Discussion

In this study, we identified and characterized ChoL, a cholesterol oxidase, as being a critical enzyme in the transformation of diosgenin to diosgenone and other 4-ene-3-keto steroids in S. virginiae IBL-14. This transformation reaction is the initial reaction in the transformation of diosgenin to rare pseudo-spirostanol sapogenins such as isonuatigenone and nuatigenone (Wang et al. 2007, 2009a, b). Disruption of ChoL in S. virginiae IBL-14 resulted in loss of the diosgenin-degrading ability, indicating that ChoL may be necessary for diosgenin degradation in the first catabolic step. This is similar to previously reported results on the important role of some cholesterol oxidases in the initial bacterial catabolic step of cholesterol and phytosterols (MacLachlan et al. 2000). The 4-ene-3-keto moiety of steroids is considered to be an important structure involved in the binding to cells and in the enzymatic process of steroid degradation (Donova 2007). This might be the reason that cholesterol oxidases play a critical role in diosgenin and sterol degradation, converting the 5-ene-3-hydroxyl to the 4-ene-3-keto moiety of the steroid nucleus.

Due to their specific oxidative functions with respect to cholesterol and phytosterols, cholesterol oxidases have been developed as important tools for the rapid quantification of cholesterol in clinical samples and phytosterols in functional food (MacLachlan et al. 2000; Moreau et al. 2003). In this study, we found that ChoL was a critical diosgenin oxidase with higher affinity to diosgenin than to cholesterol and phytosterols, indicating that ChoL may be useful as a tool for the quantitative determination of diosgenin.

Steroidal compounds are important physiologically active compounds and powerful endocrine disruptors and have attracted great attention in recent years. Many studies have focused on their fate, microbial elimination, and detection under various conditions (Ying et al. 2002; Chang et al. 2007; Horinouchi et al. 2003). It is well known that diosgenin is a widely used precursor in the partial synthesis of oral contraceptives, sex hormones, and other steroids in the pharmaceutical industry (Laveaga 2005; Wang et al. 2007). In addition, it has been confirmed that diosgenin has estrogenic effects on vertebrates (Tucci and Benghuzzi 2003; Yen et al. 2005), indicating that it is a potential endocrine disruptor in the environment. Therefore, the fate, elimination, and detection of diosgenin in the environment requires due attention. In China, it is estimated that the annual production of diosgenin is 5,000 tons (Zheng et al. 2006). However, only approximately 60% of the material is recovered (Zhang et al. 2006), indicating serious diosgenin pollution in China due to the lack of effective sewage disposal in most diosgenin-producing factories. In this study, we found that ChoL is a critical enzyme for diosgenin degradation in S. virginiae IBL-14. It may be a valuable tool in the analysis of the microbial catabolism of diosgenin and can be further developed to study the fate, microbial elimination, or rapid quantitative determination of the diosgenin pollutant in the environment.

Interestingly, the Cho genes from Streptomyces are often found within some gene clusters of secondary metabolism, for example the Cho genes pimE, pteG, and rimD from Streptomyces natalensis, S. avermitilis, and Streptomyces diastaticus, respectively (Mendes et al. 2007). Mendes et al. disclosed that pimE is required for the biosynthesis of the antifungal polyene pimaricin acting as a signaling protein via sterol detection and indicated that pteG and rimD may also play a similar role in the biosynthesis of their respective polyene antibiotics (Aparicio and Martin 2008; Mendes et al. 2007). In this study, we found that ChoL has high similarity to the cholesterol oxidases PimE and RimD (both exhibited 83% identity) and that choL is adjacent to some secondary metabolism genes in the genome of S. virginiae IBL-14, a ferredoxin gene, and a cytochrome P450 gene (data not shown). Therefore, it is conceivable that ChoL may be involved in some secondary metabolism processes in S. virginiae IBL-14. Further studies are required to validate this.

Acknowledgements

This study was funded by the National Natural Science Foundation of China (project no. 20777016), the National Basic Research Program of China (project no. 2009CB724703), and the National High Technology Research and Development Program (“863” Program) of China (project no. 2008AA02Z209).

Supplementary material

253_2009_2188_MOESM1_ESM.doc (424 kb)
ESM 1(DOC 424 kb)

Copyright information

© Springer-Verlag 2009