Applied Microbiology and Biotechnology

, 82:1067

Xylose isomerase from polycentric fungus Orpinomyces: gene sequencing, cloning, and expression in Saccharomyces cerevisiae for bioconversion of xylose to ethanol

Authors

  • Anjali Madhavan
    • Department of Biochemical Engineering and BiotechnologyIndian Institute of Technology Delhi
  • Sriappareddy Tamalampudi
    • Organization of Advanced Science and TechnologyKobe University
  • Kazunari Ushida
    • Laboratory of Animal ScienceKyoto Prefectural University
  • Daisuke Kanai
    • Research and Development Laboratories for Sustainable Value CreationAsahi Breweries, Ltd
  • Satoshi Katahira
    • Organization of Advanced Science and TechnologyKobe University
  • Aradhana Srivastava
    • Department of Biochemical Engineering and BiotechnologyIndian Institute of Technology Delhi
  • Hideki Fukuda
    • Organization of Advanced Science and TechnologyKobe University
  • Virendra S. Bisaria
    • Department of Biochemical Engineering and BiotechnologyIndian Institute of Technology Delhi
    • Department of Chemical Science and Engineering, Graduate School of EngineeringKobe University
Biotechnologically Relevant Enzymes and Proteins

DOI: 10.1007/s00253-008-1794-6

Cite this article as:
Madhavan, A., Tamalampudi, S., Ushida, K. et al. Appl Microbiol Biotechnol (2009) 82: 1067. doi:10.1007/s00253-008-1794-6

Abstract

The cDNA sequence of the gene for xylose isomerase from the rumen fungus Orpinomyces was elucidated by rapid amplification of cDNA ends. The 1,314-nucleotide gene was cloned and expressed constitutively in Saccharomyces cerevisiae. The deduced polypeptide sequence encoded a protein of 437 amino acids which showed the highest similarity to the family II xylose isomerases. Further, characterization revealed that the recombinant enzyme was a homodimer with a subunit of molecular mass 49 kDa. Cell extract of the recombinant strain exhibited high specific xylose isomerase activity. The pH optimum of the enzyme was 7.5, while the low temperature optimum at 37°C was the property that differed significantly from the majority of the reported thermophilic xylose isomerases. In addition to the xylose isomerase gene, the overexpression of the S. cerevisiae endogenous xylulokinase gene and the Pichia stipitis SUT1 gene for sugar transporter in the recombinant yeast facilitated the efficient production of ethanol from xylose.

Keywords

Xylose isomeraseOrpinomycesXylulokinaseSUT1Recombinant Saccharomyces cerevisiaeXylose fermentationEthanol

Introduction

Lignocellulosic plant material, such as corn stover, wheat straw, rice straw, etc., is an abundant source of renewable biomass which can be fermented to ethanol. Although the yeast Saccharomyces cerevisiae can ferment glucose efficiently, d-xylose, the major pentose sugar present in hemicellulosic hydrolyzates (up to 40%) remains unutilized (Chandrakant and Bisaria 1998; Katahira et al. 2004). However, it has been observed that d-xylulose, the keto isomer of xylose, can be fermented to ethanol by the yeast (Richard et al. 2000). Therefore, the engineering of S. cerevisiae, to incorporate an efficient xylose metabolic pathway, to produce xylulose, can help to maximize the overall yield and productivity of the fermentation process.

The conversion of xylose to xylulose can be mediated by two different pathways. Most xylose-assimilating eukaryotes (e.g., Pichia stipitis, Candida shehatae, and Pachysolen tannophilus) convert xylose to xylulose by two step redox reactions, catalyzed by the predominantly NADPH-dependent xylose reductase (XR) followed by the NAD+-dependent xylitol dehydrogenase (XDH), with xylitol as the pathway intermediate (Chiang and Knight 1960; Katahira et al. 2006). Such yeasts and recombinant S. cerevisiae strains producing these enzymes can ferment xylose to ethanol. However, under anaerobic conditions, the different coenzyme specificities of XR and XDH generate a cofactor imbalance which results in considerable accumulation of xylitol as a by-product and reduces the yield of ethanol (Pitkänen et al. 2003; Jin et al. 2004). In the second pathway, the metal ion-dependent isomerization of xylose to xylulose, catalyzed by the enzyme xylose isomerase (XylA), alleviates the excessive production of xylitol (Chandrakant and Bisaria 2000). The XylA pathway is functional in a majority of prokaryotes (e.g., Escherichia coli, Streptomyces sp.), a few fungi (e.g., Piromyces), and plants (Hordeum vulgare, Oryza sativa, and Arabidopsis thaliana; Sarthy et al. 1987; Kristo et al. 1996; Gárdonyi and Hahn-Hägerdal 2003; Harhangi et al. 2003).

Most of the attempts to functionally express bacterial xylose isomerases in yeast have failed. In the case of heterologous expression of the Clostridium thermosulfurogenes and the Actinoplanes missouriensis xylA genes, no protein product or enzyme activity could be detected, although xylose isomerase-specific mRNA was present (Amore et al. 1989; Moes et al. 1996). The expression of the Bacillus subtilis, E. coli, and Streptomyces rubiginosus xylA in yeast resulted in predominantly insoluble, catalytically inactive proteins, possibly due to improper folding of the prokaryotic enzymes by the eukaryotic host (Sarthy et al. 1987; Amore et al. 1989; Gárdonyi and Hahn-Hägerdal 2003). The enzyme from Thermus thermophilus is the only bacterial XylA to be heterologously expressed in active form in yeast (Walfridsson et al. 1996). However, the optimum temperature of the T. thermophilus XylA was 85°C and it retained only 4% of its activity at 30°C, resulting in the poor fermentation of xylose by the recombinant yeast (Walfridsson et al. 1996). Recently, the xylA gene from Piromyces was functionally expressed at high level in S. cerevisiae and the recombinant strain exhibited slow growth on xylose medium (Kuyper et al. 2003).

Hence, the eukaryotic origin and mesophilic temperature optimum of the xylose isomerase from the polycentric anaerobic fungus Orpinomyces renders the enzyme an ideal candidate for successful heterologous expression in yeast. The present paper reports the elucidation of the xylA sequence from Orpinomyces and its cloning and constitutive expression in the yeast S. cerevisiae. The recombinant enzyme was characterized and compared to those of its homologs. In addition, the genes for XKS from S. cerevisiae and a sugar permease SUT1 from P. stipitis were overexpressed to overcome the potential bottlenecks in the fermentation of xylose. The effects of the genetic modifications on the fermentation performance of the yeast strains developed in the study have also been evaluated.

Materials and methods

Strains and media

The anaerobic fungus Orpinomyces, isolated by enrichment culture from cattle rumen fluid, served as the source of RNA for xylose isomerase gene isolation. To extract the total RNA, Orpinomyces was cultivated at 39°C in rumen fluid–glucose–cellobiose agar medium (Lowe et al. 1985) by static culture for 4 days. The ingredients of the medium were 7.5% (v/v) of salt solution I [0.6% K2HPO4]; 7.5% (v/v) of salt solution II [0.6% KH2PO4, 1.2% (NH4)2SO4, 1.2% NaCl, 0.12% MgSO4.7H2O, and 0.12% CaCl2.2H2O]; 0.1% (v/v) of 0.1% resazurin; 0.025% (w/v) each of glucose, cellobiose, maltose, soluble starch, cysteine-HCl, and Na2S.9H2O; 40% (v/v) of rumen fluid; and 5% (v/v) of 8% Na2CO3 in 100% CO2 environment. Agar (1.5%) was added for solid medium. The bacterial strains E. coli XL1 Blue (Stratagene, CA, USA) and E. coli DH5α (Life Technologies, MD, USA) were used as transformation hosts during DNA manipulation for isolation of the xylA gene and construction of the yeast expression vectors, respectively. E. coli was grown at 37°C in Luria–Bertani medium (Sambrook and Russell 2001) containing 100 mg l−1 of ampicillin for the maintenance of plasmids. The diploid yeast strain S. cerevisiae INVSc1 (Table 1) was used as the host for construction of the xylose-utilizing yeast strains and subsequent fermentation studies. S. cerevisiae INVSc1 was grown at 30°C in YPD medium (10 g l−1 yeast extract, 20 g l−1 peptone, and 20 g l−1 glucose). The recombinant strains developed in this study and their relevant genotypic characteristics are summarized in Table 1. The yeast transformants were selected and cultivated at 30°C in synthetic SC minimal medium [20 g l−1 glucose or xylose; 6.7 g l−1 yeast nitrogen bases without amino acids (Difco, MI, USA); 0.1 g l−1 each of adenine, arginine, cysteine, leucine, lysine, threonine, tryptophan, and uracil; 0.05 g l−1 each of aspartic acid, histidine, isoleucine, methionine, phenylalanine, proline, serine, tyrosine, and valine; pH 5.5] made deficient in the appropriate amino acids. All components of the synthetic medium were sterilized by filtration through 0.2-μm pore-sized membranes.
Table 1

Microbial strains and plasmids used in the study

Strain or plasmid

Relevant feature(s)

Source/reference

Strains

 S. cerevisiae

  INVSc1

MATa his3Δ1 leu2 trp1-289 ura3-52/

Invitrogen, USA

MATα his3Δ1 leu2 trp1-289 ura3-52

  INVSc1/pWGP3

INVSc1 control strain (no expression); his3Δ1 leu2 ura3-52

Present study

  INVSc1/pRS406/pWGP3

INVSc1 control strain (no expression); his3Δ1 leu2

Present study

  INVSc1/pRS406/pRS405/pWGP3

INVSc1 control strain (no expression); his3Δ1

Present study

  INVSc1/pWOXYLA

INVSc1 (expressing xylA); his3Δ1 leu2 ura3-52

Present study

  INVSc1/pRS406/pWOXYLA

INVSc1 (expressing xylA); his3Δ1 leu2

Present study

  INVSc1/pRS406XKS/pWOXYLA

INVSc1 (expressing XKS, xylA); his3Δ1 leu2

Present study

  INVSc1/pRS406XKS/pRS405/pWOXYLA

INVSc1 (expressing XKS, xylA); his3Δ1

Present study

  INVSc1/pRS406XKS/pILSUT1/pWOXYLA

INVSc1 (expressing XKS, SUT1, xylA); his3Δ1

Present study

Plasmids

 pWGP3

TRP1 control plasmid (no expression)

Takahashi et al. 2001

 pLGP3

LEU2 control plasmid (no expression)

Katahira et al. 2004

 pRS406

URA3 control plasmid (no expression)

Stratagene, USA

 pRS405

LEU2 control plasmid (no expression)

Stratagene, USA

 pWOXYLA

TRP1 episomal vector for expression of xylA

Present study

 pLXKS

LEU2 episomal vector for expression of XKS

Present study

 pRS406XKS

URA3 integration vector for expression of XKS

Present study

 pILSUT1

LEU2 integration vector for expression of SUT1

Present study

Isolation of total RNA and gene coding for xylose isomerase

Five hundred milligrams of Orpinomyces fungal mycelium was harvested from culture broth by centrifugation and frozen with liquid nitrogen. The frozen mycelium was disrupted using a Multi-beads Shocker (Yasui Kikai, Osaka, Japan) according to the manufacturers’ instructions. Total RNA was extracted by RNeasy Mini Kit (Qiagen, CA, USA). To synthesize the partial cDNA of xylose isomerase, reverse transcriptase polymerase chain reaction (RT-PCR) was performed by Ready-to-Go RT-PCR Beads (Amersham Bioscience, NJ, USA) using total RNA as template, degenerate forward primer F1 (Table 2) and oligo dT reverse primer. Thereafter, a 390-bp fragment of the gene was amplified by nested PCR using cDNA as template with degenerate forward and reverse primers F2 and R1 (Table 2), respectively. The fragment was cloned using the pGEM-Easy Vector System (Promega, WI, USA) by TA cloning and sequenced using the Big Dye Terminator Version 3.1 cycle sequencing kit (Applied Biosystems, CA, USA) with an Applied Biosystems Inc. Prism 3100-Avant genetic analyzer. Subsequently, the complete sequence of the 1,314-bp cDNA of the xylA gene from Orpinomyces was obtained by 5′ and 3′ rapid amplification of cDNA ends (RACE) using the BD SMART RACE cDNA Amplification Kit (BD Bioscience, NJ, USA).
Table 2

PCR primers used in the study

Primer

Sequence

F1 degenerate primer

5′ CGTTTCGCCATGGCCT(G/A)(G/C)TGGCACAC 3′

F2 degenerate primer

5′ GAAAACTACGTCTTCTGGGG(T/C)GG 3′

R1 degenerate primer

5′ GGGAATTGATCAGTATCCCA(A/G/T)CC 3′

OXYLAFP

5′ CGCAGGATCCATGACTAAGGAATATTTCC 3′

OXYLARP

5′ ATCTGTCGACTTATTGGTACATGGCAAC 3′

XKSFP

5′ TAGTGGATCCATGTTGTGTTCAGTAATTCAGAGACAGAC 3′

XKSRP

5′ CAAAGTCGACTTAGATGAGAGTCTTTTCCAGTTCGC 3′

INTFP

5′ ATTACCGCGGACCAGTTCTCACACGGAACACC 3′

INTRP2

5′ GCCCGCCTCGAGTCAATCAATGAATCGAAAATGTC 3′

SUT1-SacI

5′ CGCGAGCTCATGTCTTCTCAAGATATTCCTTCAGGTGTTC 3′

SUT1-SalI

5′ CGCGTCGACTTAAACATGTTCGTCAACAGGCTTTTCATCA 3′

Degenerate oligonucleotides are shown in boldface. Restriction sites in primer overhangs (if any) are underlined

Plasmid construction

The relevant characteristics and sources of the plasmids used in the study are listed in Table 1. Standard techniques were used for nucleic acid manipulations. Restriction enzymes were purchased from New England Biolabs, MA, USA and Takara, Kyoto, Japan. KOD polymerase and Ligation High used for PCR and ligation reactions, respectively, were supplied by Toyobo Co. Ltd., Osaka, Japan. Plasmid transformations of E. coli were performed by the calcium chloride/heat shock method (Sambrook and Russell 2001).

For the high-level expression of xylose isomerase, the complete xylA gene was amplified by PCR using forward primer OXYLAFP and reverse primer OXYLARP (Table 2) to incorporate enzyme cleavage sites for BamHI and SalI (underlined sequences), respectively. The PCR-amplified gene was cloned into the 2-μm-based yeast expression vector pWGP3, under the control of the glycolytic glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter. The resultant 8.6-kb plasmid, for the constitutive expression of xylose isomerase, was designated as pWOXYLA (Fig. 1a).
https://static-content.springer.com/image/art%3A10.1007%2Fs00253-008-1794-6/MediaObjects/253_2008_1794_Fig1_HTML.gif
Fig. 1

Vectors a pWOXYLA, b pRS406XKS, and c pILSUT1 for expression of Orpinomyces xylose isomerase (xylA), S. cerevisiae xylulokinase (XKS), and P. stipitis sugar transporter (SUT1), respectively, in yeast

Plasmid pRS406XKS, used for integration of the S. cerevisiae xylulokinase gene, was constructed as follows: Genomic DNA from S. cerevisiae INVSc1 was isolated by spheroplast preparation (Cregg et al. 1985). The XKS gene was amplified by PCR from the yeast genomic DNA using forward primer XKSFP and reverse primer XKSRP (Table 2) to incorporate restriction sites for BamHI and SalI, respectively. The XKS gene was cloned into the 2-μm-based yeast expression vector pLGP3, under the control of the GAPDH promoter, and the resultant 10-kb plasmid was designated as pLXKS. Thereafter, the 3-kb fragment composed of the GAPDH promoter, XKS gene, and GAPDH terminator was amplified from plasmid pLXKS by PCR using forward primer INTFP and reverse primer INTRP2 (Table 2) to incorporate enzyme cleavage sites for SacII and XhoI, respectively. The complete XKS expression cassette was cloned into vector pRS406 and the resultant 7.3-kb plasmid, for the chromosomal integration of XKS, was designated as pRS406XKS (Fig. 1b).

Plasmid pILSUT1, used for chromosomal integration of the P. stipitis SUT1 gene, was constructed as follows: The P. stipitis SUT1 gene, cloned by Katahira et al. (2008), was amplified by PCR using forward primer Sut1-SacI and reverse primer Sut1-SalI (Table 2) to introduce restriction sites for SacI and SalI, respectively. Plasmid pLGP3 was digested with AatII to excise the 2-μm origin of replication and subsequently self-ligated. The PCR amplified SUT1 gene was ligated to the SacI–SalI site, under the control of the GAPDH promoter, and the resultant 7.9-kb plasmid was designated as pILSUT1 (Fig. 1c).

Yeast transformation

Yeast transformations were carried out using lithium acetate/single-stranded DNA/polyethylene glycol by the high efficiency transformation protocol (Gietz and Schiestl 2007). Multiple plasmids were transformed sequentially into the auxotrophic host strain. Plasmids pRS406XKS and pRS406 were linearized at the StuI site prior to transformation. Plasmids pILSUT1 and the control vector pRS405 were linearized at the EcoRV and AflII sites, respectively. Positive transformants were selected on SC glucose minimal medium plates, deficient in the appropriate amino acids, after 2 days incubation at 30°C. The relevant features of the recombinant strains developed in the present study are listed in Table 1.

Cultivation conditions

For inoculum preparation, yeast strains were cultivated at 30°C with shaking at 200 rpm for 24 h, in 25 ml of SC glucose medium taken in 100-ml capacity Erlenmeyer flasks. For characterization of the recombinant xylose isomerase and estimation of enzymatic activities, the yeast transformants were grown at 30°C and 200 rpm in 100 ml of SC glucose medium taken in 500-ml baffled shake flasks. For studies on the utilization of xylose by the recombinant strains, the inoculum culture was harvested by centrifugation, washed twice with sterile distilled water, and then inoculated into 100 ml of SC xylose medium taken in 500-ml baffled shake flasks. The strains were then cultivated aerobically at 30°C with shaking at 200 rpm. Dry cell mass was determined by the method of Katahira et al. (2006).

Preparation of cell extract

The yeast cells were harvested by centrifugation for 10 min at 8,000×g and 4°C. The cells were washed twice with 0.25 volume of chilled washing buffer (0.1 M Tris buffer, 2 mM ethylenediaminetetraacetic acid, pH 7.0) and once with chilled extraction buffer (0.1 M Tris buffer, pH 7.0). The cells were resuspended in 0.04 volume of extraction buffer containing 0.28 mM dithiothreitol and disrupted with 0.5 mm glass beads using a Multi-beads Shocker (Yasui Kikai, Osaka, Japan) according to the manufacturers’ instructions. The cellular debris was removed by centrifugation for 20 min at 20,000×g and 4°C. The supernatant was used as the intracellular extract.

Total protein assay

Total protein concentration in cell extracts was determined using the Biorad Dc Protein Assay kit (Bio-Rad Laboratories, CA, USA) with bovine serum albumin as the protein standard.

Electrophoretic procedures

Denaturing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was performed by the method of Laemmli (1970) using 12% polyacrylamide gels run at 18 mA for 120 min. Bio-Rad Precision Plus Protein Dual Colour Standards (Bio-Rad Laboratories, CA, USA) were used as the molecular weight markers. PAGE under native conditions was carried out at pH 8.3, in the absence of SDS, using 10% polyacrylamide gels. Cell extracts containing 20 μg of total protein were loaded per well. The native molecular mass of the recombinant XylA was determined by Ferguson analysis using the method described by Le et al. (2003). The Non-denaturing PAGE Protein Molecular Weight Markers kit was purchased from Sigma, MO, USA. Cell extracts of the recombinant strain INVSc1/pWOXYLA and the control strain INVSc1/pWGP3, containing 20 μg of total protein, were loaded on the gel. Native gels were run at 18 mA with different polyacrylamide concentrations in the range of 5.5% to 10%.

Enzyme assays

Xylose isomerase activity in cell extracts was determined as follows: The assay mixture (0.5 ml) containing 150 mM Tris-Cl buffer (pH 7.5), 10 mM MgCl2, and 0.1 ml of suitably diluted cell extract was equilibrated at 37°C for 5 min. The reaction was started by the addition of d-xylose to a final concentration of 50 mM. The assay was performed at 37°C for 10 min. The enzyme reaction was terminated by immersing the tubes in boiling water for 2 min and then cooling in melting ice. The xylulose produced during the enzyme reaction was quantified by high-performance liquid chromatography (HPLC) analysis (Wong et al. 1991) and further confirmed by the method of Dische and Borenfreund (1951). One international unit (IU) of xylose isomerase activity was defined as the amount of enzyme required to produce 1 μmol of xylulose per min under the assay conditions.

Xylulokinase activity was measured by monitoring the oxidation of NADH at 340 nm (Shamanna and Sanderson 1979). One IU of xylulokinase activity was defined as the amount of enzyme required to phosphorylate 1 μmol of xylulose per min under the assay conditions. The specific activity (IU mg−1) was defined as the enzyme activity per milligram of total protein.

pH and temperature studies

The effect of pH on xylose isomerase activity was studied using the standardized protocol described previously, with acetate buffers in the pH range of 4 to 6 and Tris buffers in the pH range of 7 to 9. The effect of temperature on XylA activity was studied at pH 7.5.

Fermentations

The yeast strains were grown to the active exponential phase at 30°C and 200 rpm in 450 ml of SC glucose medium taken in 1-l baffled shake flasks. The cells were collected by centrifugation at 8,000×g and 25°C for 10 min, washed twice with sterile distilled water, and inoculated into 100 ml of the fermentation medium (SC medium, pH 5.5) taken in 100-ml closed bottles equipped with a bubbling CO2 outlet. The biomass concentration used in the fermentation medium was 5 g l−1. Fermentations were performed at 30°C with mild agitation at 100 rpm with a magnetic bar.

HPLC analysis

Concentrations of xylose, ethanol, glycerol, xylulose, and xylitol were measured by HPLC using Shim-Pack SPR-Pb column (Shimadzu, Kyoto, Japan) together with RID-10A refractive index detector (Shimadzu, Kyoto, Japan). The system was operated at a flow rate of 0.6 ml min−1 and temperature of 80°C using water as mobile phase.

Hybridizations

Genomic DNA was isolated by the spheroplast method from strain INVSc1/pRS406XKS/pILSUT1/pWOXYLA (XKS, Sut1, XylA) and the reference strain INVSc1/pRS406XKS/pRS405/pWOXYLA (XKS, XylA) without SUT1 expression. The genomic DNA samples were digested with EcoRI and electrophoresed in 0.7% agarose gel. The separated fragments were blotted on to charged Hybond N+ nylon membrane (Amersham Biosciences, NJ, USA) by alkaline transfer (Sambrook and Russell 2001). Southern analysis was carried out using the Gene Images Alkphos Direct Labelling and Detection System (Amersham Biosciences, NJ, USA).The probe DNA was prepared by labeling the SUT1 gene with alkaline phosphatase and hybridization was performed under high stringency conditions at 65°C.

For Northern hybridization, total RNA from strain INVSc1/pRS406XKS/pILSUT1/pWOXYLA (XKS, Sut1, XylA) and the reference strain INVSc1/pRS406XKS/pRS405/pWOXYLA (XKS, XylA) was isolated using Purescript RNA Isolation Kit for yeast and Gram-positive bacteria (Gentra Systems, MN, USA). RNA was separated in 1.5% denaturing formaldehyde agarose gel (Sambrook and Russell 2001), blotted, and subsequently hybridized to the SUT1 probe under high stringency conditions.

Nucleotide sequence accession number

The GenBank accession number for the Orpinomyces xylose isomerase nucleotide sequence is EU411046.

Results

Isolation of the xylose isomerase gene

The partial cDNA, internal to the xylA gene, was prepared by RT-PCR from the total RNA of Orpinomyces using degenerate primers designed complementary to conserved regions of known XylA sequences. A 390-bp DNA fragment of the gene was amplified by nested PCR and sequenced. Subsequently, the complete cDNA sequence of the xylA gene was elucidated by 5′ and 3′ RACE. The 1,314-bp Orpinomyces xylA gene sequence had a total GC content of 43%.

Comparison of xylose isomerase protein sequence with corresponding known proteins

The amino acid sequence of the Orpinomyces XylA, deduced from the nucleotide sequence, encoded a polypeptide of 437 amino acids. The sequence showed 94% identity to the Piromyces sp. strain E2 xylose isomerase. Interestingly, alignment of the XylA sequences from different classes of organisms resulted in significant homology of the Orpinomyces XylA with enzymes from mesophilic prokaryotes like Bacteroides fragilis (78% identity) compared to those from eukaryotes such as A. thaliana (52% identity). The Orpinomyces XylA exhibited lower homology with the thermophilic enzymes from Thermus aquaticus and Streptomyces sp. (32% and 30% identity, respectively). Alignment of XylA with related sequences revealed the presence of extensive regions of identity (Fig. 2). Almost all residues involved in catalysis, substrate, and metal ion binding were conserved. Based on comparison with known xylose isomerases, the residues His-102, Asp-105, and Asp-340 constitute a triad directly involved in catalysis. Lys-235 plays a structural as well as a functional catalytic role (Vieille et al. 1995; Harhangi et al. 2003). The characteristic amino acid signature sequences described for xylose isomerases were also present in the Orpinomyces XylA at residues 187–196 and 231–239 (Meaden et al. 1994). Based on their sequence homology, xylose isomerases are known to divide into two families (Meaden et al. 1994; Vieille et al. 1995). Family I enzymes, including XylA from Thermus sp. and Actinomycetes, have GC rich DNA and are shorter by 40–50 residues at the N terminus. On the other hand, the family II enzymes have lower GC content and form a more heterogeneous group comprising of XylA from many bacteria and eukaryotes. The Orpinomyces XylA clustered with the family II enzymes (data not shown) and was most homologous to the enzyme from Piromyces.
https://static-content.springer.com/image/art%3A10.1007%2Fs00253-008-1794-6/MediaObjects/253_2008_1794_Fig2_HTML.gif
Fig. 2

Multiple sequence alignment of xylose isomerase proteins from Enterobacter, E. coli, Haemophilus influenzae, Piromyces, Orpinomyces, and Xanthomonas campestris. Catalytically active residues, substrate, and metal ion binding sites are indicated by boxes

Construction of S. cerevisiae strain overexpressing xylA

For the high-level intracellular production of xylose isomerase in S. cerevisiae, the xylA gene was cloned into the high copy number vector pWGP3 and the coding region was fused to the GAPDH promoter for constitutive expression in the absence of xylose induction. Figure 1a shows the physical map of the recombinant plasmid pWOXYLA used for xylA expression. Plasmids pWOXYLA and pWGP3 were transformed into the auxotrophic host strain S. cerevisiae INVSc1. The xylA-expressing recombinant strain was designated as INVSc1/pWOXYLA and the control strain as INVSc1/pWGP3.

Characterization of the recombinant xylose isomerase

The recombinant Orpinomyces XylA consisted of a single type of subunit with a molecular mass of approximately 49 kDa (Fig. 3a), which corresponded well with the calculated molecular mass of 49.4 kDa deduced from the amino acid sequence. The total cellular proteins were also electrophoresed under native conditions and the position of the recombinant XylA was determined by comparison with the control strain (Fig. 3b). The native molecular mass of the recombinant Orpinomyces XylA was 108 kDa, which indicated that the active enzyme was possibly homodimeric. Cell extract of the recombinant strain INVSc1/pWOXYLA, cultivated on glucose as carbon source, exhibited high specific xylose isomerase activity (1.91 IU mg−1), whereas no XylA activity could be detected in the control strain INVSc1/pWGP3. The dependence of XylA activity on pH was studied in the pH range of 4 to 9. The enzyme showed maximal activity at pH 7.5, while the pH profile exhibited a steep decline at higher pH values (42% and 100% loss at pH 8 and 9, respectively). The optimum temperature for XylA activity was determined to be 37°C. Moreover, the Orpinomyces XylA retained most of its activity in the lower temperature range (10% and 29% less active at 35°C and 30°C, respectively).
https://static-content.springer.com/image/art%3A10.1007%2Fs00253-008-1794-6/MediaObjects/253_2008_1794_Fig3_HTML.gif
Fig. 3

PAGE analysis of the Orpinomyces xylose isomerase expressed in S. cerevisiae. Lane M, standard protein molecular weight markers; lanes 1 and 2, cell extracts of control strain INVSc1/pWGP3 and recombinant strain INVSc1/pWOXYLA, respectively. Separation by a 12% SDS-PAGE and b 10% PAGE under nondenaturing conditions. Twenty micrograms of total protein was loaded in each lane. Molecular masses of standard proteins are indicated

Xylose utilization by the recombinant S. cerevisiae overexpressing xylA

The effect of expression of the Orpinomyces XylA in yeast was studied with respect to the utilization of xylose as the carbon source. The recombinant strain INVSc1/pWOXYLA, during aerobic shake flask cultivation in synthetic medium with 20 g l−1 xylose, exhibited growth with a specific growth rate of 0.01 h−1 (Fig. 4). Xylulose accumulation was observed till 160 h but was subsequently consumed rapidly for biomass production. On the other hand, the control strain did not consume xylose during prolonged cultivation.
https://static-content.springer.com/image/art%3A10.1007%2Fs00253-008-1794-6/MediaObjects/253_2008_1794_Fig4_HTML.gif
Fig. 4

Aerobic growth profiles of S. cerevisiae transformants on synthetic medium with 20 g l−1 of xylose as carbon source. Closed symbols INVSc1/pWOXYLA and open symbols control strain INVSc1/pWGP3. Circle xylose, triangle dry cell mass, square xylulose, and inverted triangle xylitol. Data points represent the means of three independent experiments

Construction of S. cerevisiae strain overexpressing XKS and xylA

Plasmid pRS406XKS (Fig. 1b) was used for integration and constitutive expression of the native S. cerevisiae XKS gene in yeast, while, plasmid pRS406 was used to construct the reference and control strains without the overexpression of XKS. The XKS and xylA overexpressing recombinant strain was designated as INVSc1/pRS406XKS/pWOXYLA. The reference strain expressing only xylA was designated as INVSc1/pRS406/pWOXYLA, whereas the control strain without the overexpression of XKS or xylA was designated as INVSc1/pRS406/pWGP3. Cell extract of strain INVSc1/pRS406XKS/pWOXYLA (XKS, XylA) exhibited high specific XylA (1.76 IU mg−1) and XKS (0.41 IU mg−1) activities, whereas the reference and control strains without the overexpression of XKS showed negligible xylulokinase activity.

Anaerobic fermentation of xylose by S. cerevisiae strain overexpressing XKS and xylA

The utilization of xylose for the production of ethanol by the recombinant yeast strain expressing only xylA as well as the strain expressing XKS and xylA was investigated under anaerobic conditions. During fermentation of 50 g l−1 xylose with strain INVSc1/pRS406/pWOXYLA (XylA), 5.91 g l−1 of xylose was consumed to produce 2.33 g l−1 of ethanol after 140 h of fermentation. The utilization of xylulose was slow since a concomitant accumulation of xylulose was observed during the course of fermentation (data not shown). In comparison, the strain INVSc1/pRS406XKS/pWOXYLA, which coexpressed XKS and xylA, consumed 10.41 g l−1 of xylose and produced 4.06 g l−1 of ethanol with no accumulation of xylulose in the medium. The production of by-product xylitol was low compared to ethanol in both the strains (0.86 and 0.89 g l−1, respectively). The experimental results for the ethanol yield and productivity of the strains are presented in Table 3.
Table 3

Comparison of xylose consumption and product formation among recombinant S. cerevisiae strains during fermentation of 50 g l−1 xylose

Strain

Xylose consumed (g l−1)

Products

Ethanol yielda (g g−1)

Xylitol yielda (g g−1)

Volumetric ethanol productivity (g l−1 h−1)

Carbon recoveryb (%)

XylA activity (IU mg−1)

XKS activity (IU mg−1)

Ethanol (g l−1)

Glycerol (g l−1)

Xylitol (g l−1)

INVSc1/pRS406XKS/pWOXYLA (XKS, XylA)

10.41 ± 0.32

4.06 ± 0.31

0.86 ± 0.05

0.89 ± 0.03

0.39 ± 0.02

0.09 ± 0.00

0.029 ± 0.002

93 ± 4

1.76 ± 0.04

0.41 ± 0.05

INVSc1/pRS406/pWOXYLA (XylA)

5.91 ± 0.21

2.33 ± 0.15

0.46 ± 0.03

0.86 ± 0.02

0.39 ± 0.01

0.15 ± 0.00

0.017 ± 0.001

99 ± 2

1.90 ± 0.04

<0.005

INVSc1/pRS406/pWGP3 (control)

0.29 ± 0.06

nil

0.02 ± 0.00

0.15 ± 0.01

nil

0.52 ± 0.07

nil

59 ± 9

nil

<0.005

INVSc1/pRS406XKS/pILSUT1/pWOXYLA (XKS, Sut1, XylA)

15.55 ± 0.71

6.05 ± 0.43

0.66 ± 0.05

1.28 ± 0.09

0.39 ± 0.01

0.08 ± 0.00

0.043 ± 0.003

88 ± 3

1.62 ± 0.03

0.39 ± 0.04

INVSc1/pRS406XKS/pRS405/pWOXYLA (XKS, XylA)

10.05 ± 0.41

4.05 ± 0.34

0.63 ± 0.06

0.75 ± 0.04

0.40 ± 0.02

0.07 ± 0.00

0.029 ± 0.002

92 ± 4

1.73 ± 0.04

0.41 ± 0.04

INVSc1/pRS406/pRS405/pWGP3 (control)

0.27 ± 0.06

nil

0.09 ± 0.01

0.13 ± 0.01

nil

0.48 ± 0.08

nil

83 ± 11

nil

<0.005

Values are presented as mean and standard deviation of three independent experiments; 140-h fermentation

ag (g of xylose consumed)−1

bCalculated by considering CO2 production equivalent to ethanol production

Construction of S. cerevisiae strain overexpressing SUT1, XKS, and xylA

The integration vector pILSUT1 (Fig. 1c) for constitutive expression of the P. stipitis SUT1 gene was transformed into S. cerevisiae INVSc1/pRS406XKS/pWOXYLA (XKS, XylA) and the resultant XKS, SUT1, and xylA overexpressing recombinant strain was designated as INVSc1/pRS406XKS/pILSUT1/pWOXYLA. The vector pRS405 was used to construct the reference strain INVSc1/pRS406XKS/pRS405/pWOXYLA (XKS, XylA) and the control strain INVSc1/pRS406/pRS405/pWGP3. Integration of the SUT1 gene in the yeast chromosomal DNA was confirmed by Southern hybridization. A single hybridization signal was detected with INVSc1/pRS406XKS/pILSUT1/pWOXYLA (XKS, Sut1, XylA) DNA, but not with the reference strain (data not shown). Northern analysis was performed with total RNA of the yeast strains cultivated in SC glucose medium. The positive hybridization signal with the RNA of strain INVSc1/pRS406XKS/pILSUT1/pWOXYLA (XKS, Sut1, XylA) established the active transcription of SUT1 (Fig. 5). Cell extract of this strain exhibited specific XylA and XKS activities of 1.62 and 0.39 IU mg−1, respectively.
https://static-content.springer.com/image/art%3A10.1007%2Fs00253-008-1794-6/MediaObjects/253_2008_1794_Fig5_HTML.gif
Fig. 5

Northern hybridization of SUT1 gene expressed in S. cerevisiae. Lanes 1 and 2, reference strain INVSc1/pRS406XKS/pRS405/pWOXYLA (XKS, XylA) and the SUT1 expressing strain INVSc1/pRS406XKS/pILSUT1/pWOXYLA (XKS, Sut1, XylA), respectively

Anaerobic fermentation of xylose by S. cerevisiae strain overexpressing SUT1, XKS, and xylA

The effect of expression of SUT1 was investigated on the fermentation of 50 g l−1 xylose by the xylose-utilizing S. cerevisiae strain. The recombinant strain INVSc1/pRS406XKS/pILSUT1/pWOXYLA (XKS, Sut1, XylA), after 140 h of fermentation, consumed more xylose (15.55 g l−1) and produced a higher concentration of ethanol (6.05 g l−1) when compared to the reference strain. The increased utilization of xylose was also accompanied by a marginal increase in the production of xylitol (1.28 g l−1). Table 3 summarizes the ethanol yield and productivity of the recombinant, reference, and control strains used in the present study.

Discussion

Several fungi (e.g., Neocallimastix, Caecomyces, Piromyces, and Orpinomyces) constitute the ruminal microflora of herbivorous animals to facilitate the digestion of cellulosic and hemicellulosic biomass. These symbiotic microorganisms produce most of the hydrolytic enzymes, such as cellulases and xylanases, required for the degradation of plant cell wall material under anaerobic conditions (Borneman et al. 1989). The isolation of the gene for xylose isomerase from the monocentric fungus Piromyces suggests that these fungi can subsequently assimilate the end products of hydrolysis (Harhangi et al. 2003). Based on these observations, we examined whether the related anaerobic fungus Orpinomyces could utilize xylose via the xylose isomerase pathway. The present investigation is the first report of the gene sequence, cloning, and expression of the Orpinomyces xylose isomerase in S. cerevisiae for the bioconversion of xylose to ethanol.

Studies on the recombinant XylA protein produced in yeast revealed that the enzyme was possibly a homodimer, similar to known XylA which are either homodimeric or homotetrameric with subunit molecular masses in the range of 45–50 kDa (Hess et al. 1998). The specific enzyme activity observed was similar to recent published data of the S. cerevisiae strain RWB202 which overexpressed the Piromyces xylA under the control of the TPI1 promoter (Kuyper et al. 2003). The effects of pH and temperature on XylA activity were also studied to investigate the compatibility of the enzyme with optimal growth conditions of S. cerevisiae. The enzymatic response to pH was comparable to known XylA, with maximum activity at pH 7.5. The Orpinomyces XylA exhibited optimum activity at the mesophilic temperature of 37°C, which was in contrast to the predominantly thermophilic XylA that have been reported thus far (Lee et al. 1990; Vieille et al. 1995; Kristo et al. 1996). Moreover, the enzyme retained 90% and 71% of its maximal activity at the S. cerevisiae-compatible growth temperatures of 35°C and 30°C, respectively. Therefore, there were apparent advantages of incorporating the Orpinomyces xylA to construct a recombinant strain for the efficient utilization of xylose. During the aerobic shake flask cultivation of strain INVSc1/pWOXYLA on xylose as the carbon source, the recombinant strain consumed xylose slowly with a specific growth rate of 0.01 h−1. This value was twofold higher than the growth rate observed for S. cerevisiae RWB202 strain (Kuyper et al. 2003). The low level of xylitol production during growth indicated that the xylose consumed by strain INVSc1/pWOXYLA was mostly converted to xylulose and thereby channeled into the pentose phosphate pathway (Fig. 4).

The observed slow rate of xylulose utilization suggested that metabolic pathways downstream of the xylose isomerization step, such as the phosphorylation of xylulose by xylulokinase, may act as bottlenecks for high fluxes through the pentose phosphate pathway. Furthermore, earlier literature has similarly suggested that the activity of XKS in S. cerevisiae is low for the growth on and fermentation of xylulose (Richard et al. 2000; Lee et al. 2003). Therefore, we overexpressed the S. cerevisiae native gene for XKS, in addition to xylA, so as to enhance the xylulose assimilation rate. During the anaerobic fermentation of xylose, the overproduction of XKS in strain INVSc1/pRS406XKS/pWOXYLA (XKS, XylA) led to a 1.7-fold increase in the xylose consumption rate and ethanol productivity. The improvement may be attributed to the higher level of XKS activity since xylulose accumulation was not detected during the fermentation. Toivari et al. (2001) have reported a similar marked improvement in the anaerobic xylose uptake rate (2–2.4-fold) and ethanol production (eightfold) by the overexpression of XKS in S. cerevisiae harboring the XYL1 and XYL2 genes for XR and XDH, respectively. However, the xylitol yield of 0.41 g g−1 was nearly 3.2-fold higher than the ethanol yield of 0.13 g g−1 and as such xylitol remained the major product at the end of fermentation. In contrast, in our strains, the ethanol yield of 0.39 g g−1 was 4.3-fold higher than the xylitol yield of 0.09 g g−1. Minimizing the production of xylitol is essential for the efficient fermentation of xylose because of the potential inhibition of XylA activity by xylitol (van Bastelaere et al. 1991).

In addition to the native S. cerevisiae enzymes involved in pentose sugar conversion, the first step of xylose metabolism, i.e., xylose transport into the cell across the cell membrane, may also be a limiting factor impeding the rate of xylose fermentation (Lee et al. 2002). In S. cerevisiae, xylose is transported by the HXT family of hexose transporters which has a much higher affinity for glucose when compared to xylose (Saloheimo et al. 2007). The genes SUT1, GXS1, and Trxlt1, coding for proteins involved in xylose uptake from P. stipitis, Candida intermedia, and Trichoderma reesei, respectively, when expressed in S. cerevisiae could enable the recipient strains to transport xylose into the cells (Weierstall et al. 1999; Leandro et al. 2006; Saloheimo et al. 2007). Furthermore, during cofermentation of glucose and xylose by a recombinant xylose-utilizing S. cerevisiae strain, the overexpression of SUT1 led to significant enhancement of glucose and xylose uptake rates, ethanol yield, and productivity (Katahira et al. 2008). Therefore, to investigate whether the uptake of xylose across the cell membrane in S. cerevisiae INVSc1 was limiting, the SUT1 gene was expressed constitutively. During anaerobic fermentation of xylose with strain INVSc1/pRS406XKS/pILSUT1/pWOXYLA (XKS, Sut1, XylA), 1.5-fold higher xylose consumption rate and ethanol productivity were observed compared to the reference strain INVSc1/pRS406XKS/pRS405/pWOXYLA (XKS, XylA), implying that the lack of efficient xylose transporters in S. cerevisiae may be one of the factors limiting the fermentation of the pentose sugar.

A comparison of the strains constructed in this study reveals that the overexpression of the genes for xylA, XKS, and SUT1 has enabled us to develop a recombinant yeast that exhibits superior xylose fermentation capacity than the host strain (Table 3). This strain produced ethanol as the major product of xylose fermentation with a yield of 0.39 g g−1, which was nearly fivefold higher than the yield of by-product xylitol (0.08 g g−1). Furthermore, the ethanol yield was considerably higher than those reported previously for the S. cerevisiae strain expressing the T. thermophilus xylA (0.21 g g−1) or the Hansenula polymorpha strain expressing the E. coli xylA (∼0.25 g g−1; Träff et al. 2001; Dmytruk et al. 2008). The difference may be partly explained by the high specific activity of the recombinant Orpinomyces XylA under the conditions employed for fermentation. Notably, the xylA from Piromyces, when expressed in S. cerevisiae, exhibited improved kinetics of ethanol fermentation and anaerobic growth on xylose medium only after extensive chemostat adaptation followed by the deletion of the endogenous GRE3 gene and overexpression of the native XKS gene as well as the nonoxidative pentose phosphate pathway enzymes. The engineered strain exhibited high ethanol productivity with a yield of 0.42–0.43 g g−1 and minimal xylitol formation (Kuyper et al. 2004, 2005a, b).

Thus, our work has demonstrated that metabolic engineering of S. cerevisiae by overexpression of the Orpinomyces xylA gene produced catalytically active recombinant enzyme, functional under mesophilic conditions, which enabled the strain to assimilate xylose as a carbon source. Overexpression of the endogenous S. cerevisiae XKS and the P. stipitis SUT1 genes, in addition to xylA, facilitated the efficient fermentation of xylose to ethanol with fairly high yield and low xylitol accumulation.

Acknowledgment

The author Anjali Madhavan was supported by the Council of Scientific and Industrial Research, India.

Copyright information

© Springer-Verlag 2008