Applied Microbiology and Biotechnology

, Volume 79, Issue 3, pp 451–459

The tryptophan synthetase gene TRP1 of Nodulisporium sp.: molecular characterization and its relation to nodulisporic acid A production

Authors

  • C. Ireland
    • Merck Research Laboratories
  • N. Peekhaus
    • Merck Research Laboratories
  • P. Lu
    • Merck Research Laboratories
  • R. Sangari
    • Merck Research Laboratories
  • A. Zhang
    • Merck Research Laboratories
  • P. Masurekar
    • Merck Research Laboratories
    • Merck Research Laboratories
    • Merck Research Laboratories
Applied Genetics and Molecular Biotechnology

DOI: 10.1007/s00253-008-1440-3

Cite this article as:
Ireland, C., Peekhaus, N., Lu, P. et al. Appl Microbiol Biotechnol (2008) 79: 451. doi:10.1007/s00253-008-1440-3

Abstract

Nodulisporic acid A (NAA), an insecticidal indole diterpene, is produced by the fungus Nodulisporium sp. Since indole-3-glycerolphosphate is the precursor of the indole moiety of NAA, it is suggested that the activity of tryptophan synthetase may play a role in NAA biosynthesis. To investigate this hypothesis, the tryptophan synthetase gene TRP1 of Nodulisporium sp. was cloned and characterized. The gene consists of three introns of 146, 68, and 57 bp. The four exons encode a protein of 712 amino acids, the sequence of which is highly homologous to that of other fungal tryptophan synthetase proteins. The transcription initiation site was mapped 66 bp upstream to the ATG, and the polyA tail attachment site is 169 bp downstream to the translation stop codon. Replacement of the N-terminal half of the gene with a hygromycin selection marker yielded mutants with the tryptophan auxotroph/hygromycin-resistance (trp/hyr) phenotype. The TRP1 mutants required a high concentration of tryptophan supplement in solid medium (10 mM) to sustain minimal growth and failed to produce NAA in the production medium (FFL-CAM) supplemented with high concentrations of tryptophan.

Keywords

Trytophan synthetaseNodulisporium spNodulisporic acid A

Introduction

Nodulisporic acid A (NAA), isolated from Nodulisporium sp. ATCC74245 (Ondeyka et al. 1997; Ostlind et al. 1997), has potent oral anti-flea activity in dogs and lacks overt mammalian toxicity (Shoop et al. 2001). Its mode of action is by activating a glutamate-gated chloride channel in insects (Smith et al. 2000). Nodulisporium sp. is an anamorphic, endophytic fungus most commonly isolated from woody plants (Polishook et al. 2001). The teleomorph of the fungus is unknown, but morphological and rDNA analysis suggest that it is a Hypoxylon species, close to Hypoxylon fendleri (Monaghan et al. 1995; Polishook et al. 2001; Rodrigues and Samuels 1990).

To develop NAA as an insecticide, it is necessary to increase its production yield. One of the approaches to increase the yield of a fermentation product is by manipulating its biosynthetic pathway. Studies on the biosynthesis of NAA showed that indole-3-glycerolphosphate (IGP) is the precursor of the indole moiety of NAA (Byrne et al. 2002). Organisms capable of synthesizing tryptophan use seven identical enzymatic functions in the same biochemical pathway (Yanofsky 1984). Fungal tryptophan synthetase catalyzes the final step in tryptophan biosynthesis: IGP + L-serine → L-tryptophan + glyceraldehyde-3-P (Burns and Yanofsky 1989; Skrzynia et al. 1989; Zalkin and Yanofsky 1982). Thus, IGP is a branch point for the biosynthesis of NAA and tryptophan (Fig. 1). We chose to study the tryptophan synthetase (EC 4.2.1.20) gene of Nodulisporium sp. for multiple reasons. Since IGP is its substrate, its activity may affect the amount of IGP available for the biosynthesis of NAA and hence its yield. Furthermore, the tryptophan synthetase can be used as a selection marker as has been reported for Coprinus cinereus (Binninger et al. 1987), and lastly, fungal tryptophan synthetases have been of interest in gene evolution studies (Burns et al. 1990). To date, fungal tryptophan synthetase encoding genes have been cloned from Neurospora crassa (Burns and Yanofsky 1989), Saccharomyces cerevisiae (Zalkin and Yanofsky 1982), Schizosaccharomyces pombe (gene bank accession number g2388914), C. cinereus (Skrzynia et al. 1989), and Aspergillus nidulans (Eckert et al. 2000).
https://static-content.springer.com/image/art%3A10.1007%2Fs00253-008-1440-3/MediaObjects/253_2008_1440_Fig1_HTML.gif
Fig. 1

A proposed pathway for nodulisporic acid A (NAA) biosynthesis. Indole-3-glycerolphosphate (IGP) is the precursor of the indole moiety of NAA and tryptophan

In this report, we describe the cloning, characterization, and gene disruption of the tryptophan synthetase gene TRP1 from Nodulisporium sp. and its effect on the production of NAA. During the course of this study, we also optimized a fermentation medium for NAA production by Nodulisporium sp. ATCC74245. Experiments showed that the TRP1 mutants needed a high concentration of tryptophan supplement in solid medium (10 mM) to sustain minimal growth and failed to produce NAA in fermentation media supplemented with high concentrations of tryptophan.

Materials and methods

Strains, media, and reagents

Escherichia coli strains DH5α and JM109 were from Gibco BRL (Gaithersburg, MD, USA) and Promega (Madison, WI, USA), respectively. E. coli strains XL1-blue-MR, XL2-blue, and XL-10 Gold were from Stratagene (La Jolla, CA, USA). Nodulisporium sp. ATCC74245 transformation medium, R2YE with hygromycin (Hy, 500 μg/ml) and cyclosporin (1.0 μg/ml), was prepared as described previously (Fulton et al. 1999). Potato dextrose agar (PDA) and PDA + 10 mM tryptophan media were used for scoring tryptophan auxotrophic mutants of Nodulisporium sp. Restriction endonucleases and DNA-modifying enzymes were from Gibco BRL. Chemicals were from Sigma (St. Louis, MO, USA) and Fisher Scientific (Pittsburgh, PA, USA).

DNA procedures

DNA transformation of E. coli, Southern hybridization, and other DNA procedures were carried out by standard protocols (Sambrook et al. 1989). Plasmid and cosmid DNA were isolated by Qiagen kits (Valencia, CA, USA). Genomic DNA of Nodulisporium sp. was isolated by a cell lysis procedure as described (Byrd et al. 1990). Synthetic DNA primers were made by Gibco BRL. Five nested polymerase chain reaction (PCR) degenerate primers were designed by sequence alignment of three cloned fungal tryptophan synthetase genes. These primers were used in PCR reactions to amplify tryptophan synthetase gene probes from Nodulisporium sp. genomic DNA. The PCR products were used as probes in screening a Nodulisporium sp. genomic DNA library described previously (Fulton et al. 1999). Protocols for library screening were described previously (Bowden et al. 1988; Fulton et al. 1999). PCR and sequencing primers used in this study are listed in Table 1.
Table 1

Oligonucleotides used in this study

Name

Experiment

Sequence 5′ to 3′

ts1r

5′-RACE

ctggaagtgttcgcgcg

ts3r

5′-RACE

gccttcctctaactggg

ts1f

3′-RACE

aggacgtgacggtcaac

RTPCR-2

3′-RACE

gagggaagacttgaacc

tsprimer3

3′-RACE

cttccgaatgcggttgc

CNP4

3′-RACE

ccctagtgtgaaactgc

Dp1

Gene disruption

cgggatcctgccggtaacggtgttc

Dp2

Gene disruption

cgggatccttaagccacccttatcc

ts2r

Gene disruption

cgtgtgcgttacagaag

ts6f

Gene disruption

ccataaagactgtgcac

PNP100

PCR TRP3 probe

cgggatcctnytnatgggntaytayaaycc

PNP102

PCR TRP3 probe

cgggatccaancknarrtcccanccdatytt

PNP103

PCR TRP3 probe

cgggatccytgnacrtcyttrtcnccnck

PNP106

PCR TRP3 probe

cgggatcctggytnaarmgngargayytnaa

PNP107

PCR TRP3 probe

cgggatccttnarrtcytcnckyttnarcca

Oligonucleotides used in determining genomic and DNA and cDNA sequence of the TRP3 locus are not listed in the table. For degenerate oligonucleotides, d A/T/G, k T/G, m A/C, r A/G, n A/C/T/G, y C/T

Nucleotide and amino acid sequence analysis

The nucleotide sequence of a 5.3-kb EcoRI DNA fragment, which contained the tryptophan synthetase gene and flanking DNA of Nodulisporium sp., was determined by a random partial Sau3AI DNA fragments sequencing procedure. Sequencing was performed using an ABI 377 automated sequencer (PE Biosystems, Foster City, CA, USA). DNA sequence fragments were assembled into contigs using Sequencher version 4.0.2 (Gene Codes, Ann Arbor, MI, USA). Multiple sequence alignment was performed using the ClustalX version 1.8.

RNA and cDNA procedures

For total RNA isolation, mycelia of Nodulisporium sp. ATCC74245 grown in acetate medium (per liter: glucose, 0.5 g; Difco yeast extract, 1 g; potassium acetate, 10 g) were harvested using Miracloth (Calbiochem, La Jolla, CA, USA). Mycelia were then collected, frozen in liquid nitrogen, and dried in a vacuum centrifuge (SpeedVac, SVC100, Framingdale, NY, USA). The dried mycelia were ground to powder and the Tri Reagent RNA isolation kit (MRC, Cincinnati, OH, USA) was used to isolate the RNA. RNA was precipitated by addition of isopropanol and solubilized in water. RNA Reliant Gels (Promega) were used to quantify and visualize RNA in addition to optical density determination at 260 nm. The Promega PolyATract mRNA Isolation system was used to isolate mRNA. Complementary DNA (cDNA) fragments were synthesized using the Perkin-Elmer GeneAmp Thermostable rTth reverse transcriptase RNA PCR kit (RT-PCR). Introns were identified by comparison of the genomic and cDNA sequences of the gene. The 5′ rapid amplification of cDNA ends (RACE) kit Version 2.0 (Life Technologies, Rockville, MD, USA) was used to determine the 5′ end of the message. The two primers used in the 5′ RACE experiment were ts1r and ts3r. The polyA attachment site of the gene was mapped by the 3′-RACE System for Rapid Amplification of cDNA Ends Kit (Life Technologies). The four primers used in the 3′ RACE experiment were ts1f, tsprimer3, and CNP4.

Gene replacement construct

The gene replacement plasmid pTSHyg was constructed as follows: A 5.3 kb DNA fragment containing the tryptophan synthetase gene was generated using PCR primers with BamHI linkers DP1 and DP2 and subcloned into pUC18 (Stratagene) to give pUCNS-trp. The 1.1 kb NcoI fragment, which contains the N-terminal portion of the tryptophan synthetase gene in pUCNS-trp, was then replaced by the 3.5 kb BglII/XbaI Hy-resistant cassette isolated from pMLF2 (An et al. 1996) by blunt-end ligation to give pTSHyg. The gel-purified 7.7 kb BamHI fragment was used in Nodulisporium sp. transformation.

Isolation of gene disruption mutants

Protoplasting and transformation of Nodulisporium sp. ATCC74245 were performed as described (Fulton et al. 1999; Yelton et al. 1984). Transformation plates were incubated at 25°C in darkness. Hy-resistant colonies appeared about 10 days after plating. Hy-resistant transformants were screened for the tryptophan auxotrophic phenotype by plating the transformants on both PDA and PDA + 10 mM tryptophan media.

Fermentation

To prepare inoculum, 50 ml of S3 seed medium in 250-ml unbaffled Erlenmeyer flasks was inoculated with 1 ml of frozen vegetative mycelium. One liter of S3 medium (pH 6.0) contains monosodium glutamate, 10 g; NH4Cl, 3 g; MES, 20 g; K2HPO4, 1 g; MgSO4 7H2O, 0.5 g; glucose, 50 g; CaCO3, 1 g; Amicase, 2 g; and trace elements 1B, 20 ml. One liter of trace elements 1B contains FeSO4·7H2O, 0.5 g; ZnSO4·7H2O, 0.5 g; MnSO4·H2O, 0.1 g; CuSO4·5H2O, 0.05 g; and CoCl2·6H2O, 0.04 g. The flasks were shaken at 220 rpm and at 29°C for 72 h in the dark. For the production of NAA, 250-ml unbaffled Erlenmeyer flasks with 40 ml of NAA production medium (FFL-CAM) were inoculated with 1 ml of homogenized seed inoculum. One liter of FFL-CAM contains monosodium glutamate, 2 g; NH4Cl, 4.6 g; MES, 20 g; K2HPO4, 1 g; MgSO4 7H2O, 0.5 g; glycerol, 80 g; glucose, 74 g; CaCO3, 1 g; amicase, 1 g; L-tryptophan, 1 g; lactic acid (85%), 5 ml; and trace elements 1B, 20 ml. The flasks were shaken at 220 rpm and at 29°C for up to 21 days in the dark.

NAA analysis

Fermentation samples in FFL-CAM medium were taken at 7, 10, 14, 17, and 21 days. After pH determination, the contents of the flasks were homogenized. Aliquots of 10 ml homogenate were extracted with 20 ml of mitogen-activated and extracellular signal-regulated kinase. The solvent was evaporated to dryness and resuspended in 1 ml of methanol for high performance liquid chromatography (HPLC) analysis. Production of NAA was measured using an 1100 series HPLC instrument (Agilent Technologies, Waldbronn, Germany) with the following conditions: column, Symmetry ODS C18 (Waters, Milford, MA, USA); solvent mixture, 0.1% Trifluoroacetic acid 35% and acetonitrile 65%; flow rate, 0.9 ml/min; column temperature, 50°C; and detection, 270 nm.

Dry weight determination

Fermentation was carried out as described above and sampled at 7, 10, 14, 17, and 21 days. Samples were homogenized, and 2 ml aliquots were spun at 3,500 rpm for 10 min. Supernatant was saved for the analysis of carbohydrates and tryptophan. Cell pellets were rinsed three times in 5 ml deionized H2O and resuspended in 2 ml deionized H2O by vortexing. Samples were pipetted into tared weigh boats and dried to constant weight in a vacuum oven at 60°C with a vacuum of 20 in. of mercury. Dry weights were determined in duplicate for each sample.

Carbohydrate analysis

Supernatants prepared as described above were diluted 1:4 with sterile deionized H2O. Diluted samples were filtered through a 0.45 μM filter to remove the particulates. Spectra-Physics System P4000 (Bio-Rad, Hercules, CA, USA) was used for sugar detection using an Aminex HPX-87H HPLC column. The column was run isocratically at 50°C with 0.005 M H2SO4 at a flow rate of 0.7 ml/min, and the carbohydrates were detected with a refractive index detector.

Tryptophan analysis

To quantitate residual tryptophan in the medium, fermentation supernatant was first derivatized as previously described (Marfey 1984). The reaction was carried out at 40°C for 1.5 h. The reaction was stopped by addition of 80 μl of 1 M HCl, and methanol was added to bring the final volume to 1 ml. This was assayed using the 1100 series HPLC instrument with the following conditions: column, Symmetry ODS C18, solvent mixture, 0.1% aqueous trifluoroacetic acid 90% and acetonitrile 10%; flow rate, 1.0 ml/min; column temperature, 25°C; and detection, 340 nm.

GenBank accession number

The DNA and amino acid sequences for TRP1 of Nodulisporium sp. has been deposited in the GenBank database with the accession number AY206418.

Results

Cloning the Nodulisporium sp. tryptophan synthetase gene

A 1.9-kb DNA probe, which contains part of the tryptophan synthetase gene of Nodulisporium sp., was generated by PCR using degenerate primers designed from sequence alignment of tryptophan synthetase genes of Neurospora crassa (Burns and Yanofsky 1989), Schizosaccharomyces pombe (accession no. O13831 and g2388914), and Saccharomyces cerevisiae (Zalkin and Yanofsky 1982). Screening of a Nodulisporium sp. cosmid genomic library using the 1.9-kb PCR fragment resulted in two hybridizing cosmids: pNSTRP-1 and pNSTRP-2. The cosmids contained overlapping DNA fragments, and the cloning effort was focused on cosmid pNSTRP-2 because it contained a larger DNA insert. Restriction and Southern blot analysis showed that a 12-kb BamHI fragment in pNSTRP-2 contained the tryptophan synthetase gene and its flanking regions, and it was subcloned in pUC18 to give pUCB12. A 5.3-kb sequence contig within the 12-kb BamHI fragment was assembled. Analysis of the sequence showed that an internal 2.4 kb sequence of the 5.3-kb DNA shared significant sequence identity with the tryptophan synthetase genes of Neurospora crassa, A. nidulans, Saccharomyces cerevisiae, Schizosaccharomyces pombe, and C. cinereus (Table 2).
Table 2

Comparisons of six fungal tryptophan synthetases and their encoding genes

Fungus

Nodulisporium sp.

Neurospora crassa

Aspergillus nidulans

Saccharomyces cerevisiae

Schizosaccharomyces pombe

Coprinus cinereus

Gene name

TRP1

TRP-3

trpB

TRP5

SPAC19A8

TRP1

Intron number

3

2

1

0

0

9

Protein size (aa)

712

708

723

707

697

702

Identity to TRP1 (%)

100

82

72

61

60

56

A domain to TRP1 (%)

100

76

68

57

53

50

B domain to TRP1 (%)

100

91

82

72

72

65

Connecting region (aa)

58

54

69

45

40

40

RT-PCR message analysis, transcription start site, and polyadenylation site

The cDNA sequence of the gene was determined by RT-PCR using primers designed to generate overlapping cDNA fragments. Comparison of the cDNA and genomic sequences of the genes revealed three introns. The sizes of the three introns are 146, 68, and 57 bp, respectively.

The transcription initiation site of the gene was identified at 66 bp upstream of the expected translation start codon by 5′-RACE experiment. The same site was mapped by primers ts1r and ts3r, located downstream of the first two introns of the gene. The sequences of the two RT-PCR products had both introns 1 and 2 excised indicating the correct cDNA fragments were isolated.

The transcription termination site of the gene was identified at 169 bp downstream of the translation stop codon (TAA) by 3′-RACE experiment. The same site was mapped with four different primers upstream of the translation stop codon. Two of the four primers (RTPCR-2 and ts1f) are located upstream of the third intron. As expected, the sequence of these RT-PCR products had the intron excised. These results indicate that the correct transcription termination site for the gene was mapped.

Based on the sequence alignment with the Neurospora crassa gene and the consensus fungal nucleotide sequence flanking the translation start codon of fungal genes [CA(C/A)(A/C)ATGGC] (Ballance 1991), the ATG start codon for the Nodulisporium sp. tryptophan synthetase gene was predicted (CACCATGGA). The translation termination codon TAA was also predicted based on the sequence alignment with the Neurospora crassa gene.

Disruption of the Nodulisporium sp. tryptophan synthetase gene

Nodulisporium sp. ATCC74245 was transformed with the tryptophan synthetase gene disruption cassette to Hy resistance on R2YE medium supplemented with 10 mM tryptophan. In two separate transformation experiments, a total of 32 Hy-resistant transformants were screened for tryptophan auxotrophic phenotype. Of the 32 transformants, six grew only on PDA supplemented with 10 mM tryptophan, suggesting a 20% homologous double crossover recombination. These six tryptophan auxotrophic transformants were named Nodulisporium sp. NSΔTS 1 to 6, respectively. Figure 2 shows the strategy for constructing the tryptophan synthetase gene disruption mutants in Nodulisporium sp. The double-crossover replacement event for the six mutants was first analyzed by PCR using primers flanking the gene replacement sites (ts2r, 5′-CGTGTGCGTTACAGAAG and ts6f, 5′-CCATAAAGACTGTGCAC). A PCR DNA fragment of 2,049 bp is expected for the wild-type Nodulisporium sp. ATCC74245 using ts2r and ts6f as primers (Fig. 2a), and a PCR DNA fragment of 4,690 bp should be produced for the six TRP1 mutants using ts2r and ts6f as primers (Fig. 2a). The PCR experiment indicated that all six transformants were the result of a single event homologous double recombination (Fig. 2b). Genomic DNA from the mutant and wild-type strains were tested on a Southern blot with two probes. As expected, the results revealed that, in all six transformants, the 1.1 kb NcoI fragment, which contains the N-terminal half of the gene, was replaced with the 3.5-kb DNA fragment, which contains the Hy selection cassette (data not shown).
https://static-content.springer.com/image/art%3A10.1007%2Fs00253-008-1440-3/MediaObjects/253_2008_1440_Fig2_HTML.gif
Fig. 2

Construction of tryptophan synthetase gene disruption mutant strains by transformation of Nodulisporium sp. with the hygromycin (Hy) selection marker. a Features of the wild-type TRP1 locus, the gene disruption cassette, and the mutant locus. b PCR analyses of double-crossover gene replacement event for TRP1 mutants. Lane assignment: 1, kb DNA ladder; 2, no DNA control; 3 to 9, Nodulisporium sp.TRP1 gene disruption mutants NSΔTS 1 to 6; 10, Nodulisporium sp. wild-type ATCC74245. A PCR DNA fragment of 2,049 bp was generated using genomic DNA of wild-type Nodulisporium sp. ATCC74245 as template and ts2r and ts6f as primers. A PCR DNA fragment of 4,690 bp was generated using genomic DNA of the six TRP1 mutants as template and ts2r and ts6f as primers

Kinetics of NAA production by TRP1 Mutants

One of the six tryptophan synthetase mutants (NSΔTS1) and the wild-type strain of Nodulisporium sp. (ATCC74245) were grown in FFL-CAM medium supplemented with 5 mM tryptophan. Data for glucose, glycerol, tryptophan utilization, and nodulisporic acid production was collected at five time points, 7, 10, 14, 17, and 21 days. Data for dry cell weight was collected at four time points, 10, 14, 17, and 21 days. The wild-type strain showed a linear increase in growth, which peaked at day 17 (Fig. 3c). The TRP1 mutant growth rate was similar to the wild-type strain during the first 10 days, but there was no significant additional growth between days 10 and 21 (Fig. 3c). The glucose utilization by the wild-type strain and the mutants was similar, and glucose was depleted by day 10 in both cases (Fig. 3a). Glycerol was depleted by the wild-type strain at day 17, but there was still more than 40% glycerol remaining in the mutant cultures after 21 days of fermentation (Fig. 3b). Tryptophan utilization by both wild type and the mutant was similar, with no detectable extracellular tryptophan found after day 7 (data not shown). Production of NAA started after 10 days for the wild-type strain and reached 5.7 mg/l after 21 days. In contrast, no detectable NAA was produced by the mutant during the same period (Fig. 3d).
https://static-content.springer.com/image/art%3A10.1007%2Fs00253-008-1440-3/MediaObjects/253_2008_1440_Fig3_HTML.gif
Fig. 3

Components measured during the 21-day fermentation in FFL-CAM media for the tryptophan auxotroph and wild-type Nodulisporium sp. strains. a Glucose utilization measured at 7, 10, 14, 17, and 21 days. b Glycerol utilization measured at 7, 10, 14, 17, and 21 days. c Dry cell weight measured at 10, 14, 17, and 21 days. d NAA (Nodulisporic acid A) production measured at 7, 10, 14, 17, and 21 days

Discussion

The significant amino acid sequence homology between the TRP1 gene and other fungal tryptophan synthetase encoding genes suggests that TRP1 encodes tryptophan synthetase in Nodulisporium sp. The tryptophan auxotrophic phenotype associated with TRP1 disruption mutants further demonstrates that we have cloned the tryptophan synthetase gene from Nodulisporium sp. The transcription termination site of TRP1 was mapped at 169 bp downstream of the last codon, and this falls in the range of untranslated 3′ RNA in Neurospora crassa, which is between 27 and 540 bp (Bruchez et al. 1993). No clear eukaryotic polyadenylation signal (AATAAA or AATAA) was found upstream of the poly(A) tail, but an AATTCA sequence 19 bp upstream of the poly(A) tail could be the polyadenylation signal of TRP1.

The three introns in TRP1 are 146, 68, and 57 bp in size, and this range is within the 52–367 bp range of introns in Neurospora crassa (Radford and Parish, 1997). All three introns have the 5′-XX/GT and 3′-XX/AG splicing consensus junctures, and CT(A/G)A(T/C) consensus lariat sequence can be found in two of the three introns. The amino acid sequences of the six fungal tryptophan synthetase genes are compared in Table 2. The first two introns of TRP1 are located near the 5′ end of the gene. This is similar to the two introns in the TRP-3 of Neurospora crassa, but the third intron in TRP1 is not present in the Neurospora crassa TRP-3 gene (Burns and Yanofsky 1989). In contrast, the trpB gene of A. nidulans contains only one intron (Eckert et al. 2000), the C. cinereus TRP1 open reading frame is disrupted by nine introns (Skrzynia et al. 1989), and there are no introns in either TRP5 of Saccharomyces cerevisiae or the Schizosaccharomyces pombe tryptophan synthetase genes (Zalkin and Yanofsky 1982). Evolution studies suggest that fungal tryptophan synthetase genes were gene fusion products of the separate tryptophan synthetase α and β polypeptides of bacteria (Burns et al. 1990; Burns and Yanofsky 1989). It is not clear whether introns were acquired or lost during the course of tryptophan synthetase gene evolution, since some of the fungal genes contain introns and others do not. Phylogenetic analysis of the six fungal tryptophan synthetase proteins grouped the Nodulisporium sp. TRP1, the A. nidulans trpB, and the Neurospora crassa TRP-3 into one group, the Saccharomyces cerevisiae and the Schizosaccharomyces pombe protein into another group, and the C. cinereus TRP1 was branched as its own group (data not shown). This is not surprising, since Nodulisporium sp., A. nidulans, and Neurospora crassa are all filamentous ascomycetes, Saccharomyces cerevisiae and Schizosaccharomyces pombe are yeasts, and C. cinereus is the only basidiomyceteous fungus in the group. The B domains are more conserved than the A domains in the six fungal tryptophan synthetases (Table 2). DNA sequences that connect the A and B domains share no similarities but are of similar length (ranging from 40 to 69 bp; Table 2). In all six proteins, the connecting regions are flanked by a tyrosine at the N terminus and a proline at the C terminus (data not shown). This finding supports the hypothesis that the connecting region serves as a tether linking the two independent functional domains and that the length of the connecting region is more critical than its sequence (Burns et al. 1990; Burns and Yanofsky 1989). It is interesting that the connecting region in the A. nidulans trpB protein is considerably longer (69 aa) than that of the other five fungal tryptophan synthetase proteins (ranging from 40 to 58 aa in length, Table 2).

The homologous gene replacement rate for TRP1 is about 20%. In contrast, the homologous gene replacement rate for the pks1 gene of Nodulisporium sp. was over 70% (Fulton et al. 1999). The difference in the homologous recombination rate may be due to the length of the homologous DNA flanking the selection marker of the disruption construct. In the TRP1 disruption cassette, the lengths of the homologous flanking DNAs were 1.5 and 2.5 kb, but in the pks1 disruption construct, the flanking DNAs were 3 and 4.6 kb in length (Fulton et al. 1999).

Tryptophan synthetase gene disruption mutants of Nodulisporium sp. were unable to grow on unsupplemented PDA medium but grew on PDA containing 10 mM tryptophan. Deletion of the tryptophan synthetase gene trpB in A. nidulans requires 100 μM for vegetative growth on solid medium and 30 mM for normal spore pigmentation (Eckert et al. 2000). The addition of 50 mM tryptophan in solid medium can induce cleistothecia primordia formation in A. nidulans trpB-deletion strains, but no viable ascospores were produced (Eckert et al. 2000). The requirement of high tryptophan concentration by A. nidulans trpB-deletion strain was suggested to be due to limitation in uptake capacity (Eckert et al. 2000). Tryptophan exhaustion by day 7 in the Nodulisoporium sp. tryptophan synthetase gene disruption mutants indicated that there was no limitation in uptake capacity.

Fermentation medium FFL-CAM was optimized for NAA production by the wild-type strain under various tryptophan concentrations from 2.5 to 50 mM. Tryptophan supplement at 5 mM supported the minimum growth of the mutant strain and had no negative impact on the growth and NAA production in the wild-type strain. The mutant strain grows well at tryptophan concentrations up to 50 mM; however, toxicity was observed in the wild-type strain at such high concentrations (data not shown).

Growth of the mutant in FFL-CAM as determined by dried biomass was similar to the wild type in the first 10 days, but the growth stopped after day 10, while the wild type continued to grow. During the first 10 days, both the wild type and the mutant depleted glucose in the medium. Since Nodulisporium sp. cannot use glycerol as a carbon source for growth (unpublished finding), the carbon source for subsequent growth of the wild type must have come from the stored metabolites of glucose. It was interesting that even though glycerol could not be used for growth, it was metabolized completely by the wild type and over 50% by the mutant. For wild type, as shown in Fig. 3, glycerol utilization occurred concurrently with the production of NAA. In contrast, despite substantial utilization of glycerol, no NAA was made by the mutant. Even at 50 mM tryptophan concentration, no NAA production was observed by the mutant strain (data not shown). It is proposed that glycerol provides the precursors and energy for the synthesis of NAA; however, the role of glycerol in the synthesis of NAA is not well understood. Disruption of TRP1 and exhaustion of tryptophan by day 7 (data not shown) should have increased the precursor of the indole moiety IGP (Byrne et al. 2002) available for the biosynthesis of NAA, so it could not have been limiting. Furthermore, metabolism of glycerol suggests that energy and precursors for mevalonate pathway were also available. A possible explanation is that tryptophan is involved in the regulation of the NAA biosynthetic pathway. It is known that tryptophan is a precursor of ergot alkaloids and induces their biosynthesis (Floss and Mothes 1964; Vining 1970). The target of the action of tryptophan was identified as dimethylallyltryptophan synthetase, the first enzyme of alkaloid biosynthesis (Krupinski et al. 1976). If tryptophan plays a similar role in NAA biosynthesis, its low intra-cellular concentration in the auxotroph may result in the lack of induction of the pathway and therefore NAA production.

The TRP1 mutants of Nodulisporium sp. were readily transformed to prototrophy with TRP1, and therefore, TRP1 can be used as a selectable marker for Nodulisporium sp.

Acknowledgments

We thank John Ondeyka for the preparation of Fig. 1; Thomas Fulton for use of the Nodulisporium sp. genomic cosmid library, and Maria Losada for assistance in the RNA experiments. We also thank William Strohl, Jan Tkacz, Richard Monaghan, and Thomas Fulton for critically reading the manuscript.

Copyright information

© Springer-Verlag 2008