Immunogenetics

, Volume 65, Issue 1, pp 37–46

Characterisation of four major histocompatibility complex class II genes of the koala (Phascolarctos cinereus)

Authors

  • Quintin Lau
    • Faculty of Veterinary ScienceThe University of Sydney
  • Sarah E. Jobbins
    • Faculty of Veterinary ScienceThe University of Sydney
  • Katherine Belov
    • Faculty of Veterinary ScienceThe University of Sydney
    • Faculty of Veterinary ScienceThe University of Sydney
Original Paper

DOI: 10.1007/s00251-012-0658-5

Cite this article as:
Lau, Q., Jobbins, S.E., Belov, K. et al. Immunogenetics (2013) 65: 37. doi:10.1007/s00251-012-0658-5

Abstract

Major histocompatibility complex (MHC) class II molecules have an integral role in the adaptive immune response, as they bind and present antigenic peptides to T helper lymphocytes. In this study of koalas, species-specific primers were designed to amplify exon 2 of the MHC class II DA and DB genes, which contain much of the peptide-binding regions of the α and β chains. A total of two DA α1 domain variants and eight DA β1 (DAB), three DB α1 and five DB β1 variants were amplified from 20 koalas from two free-living populations from South East Queensland and the Port Macquarie region in northern New South Wales. We detected greater variation in the β1 than in the α1 domains as well as evidence of positive selection in DAB. The present study provides a springboard to future investigation of the role of MHC in disease susceptibility in koalas.

Keywords

KoalaPhascolarctos cinereusMHC class IIMarsupialDiversity

Introduction

The koala (Phascolarctos cinereus) is an iconic medium-sized folivorous diprotodont marsupial, native to the eastern states of mainland Australia and translocated to Kangaroo Island and other areas of South Australia (Lee and Martin 1988). Many koala populations face urbanisation and development of their habitat, which leads to habitat loss, population fragmentation and motor vehicle- and dog-related injuries, and it appears likely that diseases, such as chlamydiosis, also impact on the viability of koala populations (Melzer et al. 2000; Dique et al. 2003; Lunney et al. 2007).

Chlamydiosis caused by Chlamydophila pecorum and Chlamydophila pneumoniae is the most common infectious disease of wild koalas (Jackson et al. 1999). Clinical signs include proliferative conjunctivitis and urinary and reproductive tract diseases (Obendorf and Handasyde 1990), and susceptibility of koalas varies among populations (Jackson et al. 1999; Griffith et al. 2013). Genetic diversity also differs among populations; koalas from Southern Australia have low diversity at six microsatellite loci (HE = 0.436, A = 5.3), whilst koalas from the north (New South Wales, South East Queensland) have twice the diversity (HE = 0.851, A = 11.5) (Houlden et al. 1996). Genetic diversity has not yet been investigated in association with disease ecology of koalas, because until recently (Jobbins et al. 2012), relevant immune gene loci had not been examined.

Major histocompatibility complex class II (MHCII) genes encode molecules that are expressed on professional antigen-presenting cells and bind, process and present antigenic peptides to T helper lymphocytes. Activation of T helper lymphocytes is essential for coordination of antibody- and cell-mediated adaptive immunity, including class switching of antibody production from IgM to IgA, IgE and most IgG isotypes (Kalish 1995; Balakrishnan and Adams 1995). MHCII molecules present exogenous antigens and are therefore expected to be particularly relevant to processing of chlamydial antigens (Morrison et al. 1995). The three known marsupial-specific major histocompatibility complex (MHC) class II gene families are not orthologous to eutheria and are thus termed DA, DB and DC (Schneider et al. 1991; Belov et al. 2004; Belov et al. 2006). Marsupials also share the non-classical class II DM gene family with eutherians (O’HUigin et al. 1998). The MHCII molecules are heterodimers with a non-covalently associated α and β chains, each with an α1 or β1 domain that contains much of the peptide binding region (PBR), an immunoglobulin-like α2 or β2 domain and a transmembrane region. It is broadly assumed that α and β chains form heterodimers as in eutheria, with the proximity of DB α1 (DBA) and DB β1 (DBB) genes to each other providing some supportive evidence of this in marsupials (Siddle et al. 2011). An RFDS binding motif is found in the β1 domain and is important for binding to CD4+ T helper cells (Mazerolles et al. 1988). The PBR, formed by a cleft between the α1 and β1 domains, is encoded by exon 2 of both molecules and is the most variable region of the MHC molecule (Brown et al. 1993); diversity at such sites enables MHCII molecules to bind a wide range of antigens, thereby allowing the host immune system to respond to a range of pathogens (O’Brien and Evermann 1988). For this reason, exon 2 is a commonly used molecular marker to assess functionally significant genetic diversity in populations (Ohta 1998; Sommer 2005).

Observations in immunopathology of koalas provide additional impetus to investigate MHCII of the koala. Although apparently functional expression of MHCII has been demonstrated in koala tissues and lymphocytes (Canfield et al. 1996; Lau et al. 2012), Higgins et al. (2005) speculated that florid lymphoplasmacytic infiltrates that exist in Chlamydophila-infected tissue in the absence of elevated anti-chlamydial hsp60 IgG titres might originate from local cellular responses (Stephens 2003), which are independent of MHCII function. Limited activity of MHCII pathways might result from reduction in MHCII diversity or an evolved reliance on innate over adaptive immune responses, perhaps related to the koala’s solitary lifestyle (Mitchell 1990), and likely absence of a sexually transmitted disease until relatively recent times (Marsh et al. 2011).

Jobbins et al. (2012) conducted a preliminary study of koala MHCII DA β1 (DAB) diversity using primers developed for macropods (Browning 2009) and identified 15 apparently functional DAB variants, as well as several atypical variants putatively defined as pseudogenes. In this study, we designed and used koala-specific primers to describe the α1 and β1 domains of the DA and DB gene families in the koala.

Materials and methods

Primer design

In order to design primers to amplify exon 2 of all loci of the DA and DB MHCII genes, koala-specific complementary DNA (cDNA) sequence was generated, spanning exons 1 to 3 of each gene. To generate this sequence, RNA was extracted from the spleen or blood of five koalas from South East Queensland and five additional captive koalas from Sydney Wildlife World, using Trizol reagent and protocol, and reverse transcribed to cDNA using an oligo-dT cDNA synthesis kit (Fermentas, Glen Burnie, MD, USA). Primers were designed, based on conserved regions in exons 1 and 3, and identified from aligned marsupial cDNA sequences of DA α1 (DAA) (Slade and Mayer 1995), DBA (Belov et al. 2006), DAB (Lam et al. 2001; Schneider et al. 1991) and DBB (Belov et al. 2004; Browning et al. 2004; Schneider et al. 1991) (Supplementary material A). Primer sequences and annealing temperatures are outlined in Table 1. PCR products were sequenced directly, and conserved regions identified at the ends of exon 2 were used to design a second set of primers to amplify 247–282 bp fragments of exon 2 in each of the four genes (Table 1, Supplementary material B). This approach to primer design is intentionally biased towards the amplification of functional loci, which have conserved sequence integrity at exon 1 and 3 primer sites, and an absence of deletions sufficient to shorten the amplicon, in contrast to the multiple genetic lesions in atypical variants previously amplified by Jobbins et al. (2012).
Table 1

Summary of primers designed in this study within exons 1 and 3 to amplify complete exon 2 in cDNA, and within exon 2 to amplify in gDNA

Primer pair

Primer sequence

Annealing temperature (°C)

Region amplified

Amplified fragment size (bp)

DAA

 DAAleadF

5′- GRCYYCCAACAAAKCCTKGATCC -3′

56

Exons 1–3 cDNA

400

 DAAEx3R

5′- CATAGWAATCRGTGGCAGAGG -3′

 DAAEx2F

5′- AGAGAAGCATGTGATCATCC -3′

54

Exon 2 gDNA

247

 DAAEx2R

5′- GTTGGTGTCAGGGGTGTTGT -3′

DAB

 DABleadF

5′- AGAGGTTCTGGCTGTGACC -3′

56

Exons 1–3 cDNA

720

 DABEx3R

5′- ACCACGATTTCCTTTCTGACTCC-3′

 DABEx2F

5′- ATGCCCCAAAGCACTTCAC -3′

57

Exon 2 gDNA

271

 DABEx2R

5′- CGCACTRAGAAGGGCTCA -3′

DBA

DBAleadF

5′- CTGCTSAGTCCCYRRGSA -3′

54

Exons 1–3 cDNA

400

DBAEx3R

5′- CRRAGCCAYKTGATGTYGACC -3′

DBAEx2F

5′- GGGGGTCYATGGCACAMATA -3′

54

Exon 2 gDNA

251

DBAEx2R

5′- CACTGATGGCCCTGGTTCT -3′

DBB

DBBleadF

5′-TGGAAGATTGGTCTGTTGATGAC -3′

56

Exons 1–3 cDNA

520

DBBEx3R

5′-CTGGTAGGTCCAGTCTCC-3′

DBBEx2F

5′-AGGGACATCCCAGAGGATTTCG-3′

54

Exon 2 gDNA

282

DBBEx2R

5′-TCTTCTGTCCACCGCGAAGG-3′

PCR amplifications were carried out in an Eppendorf Mastercycler® PCR Cycler in 25 μl reactions containing 10–30 ng of DNA, 0.32 μM each primer (Sigma-Aldrich, Sydney, Australia), ×1 HotStarTaq DNA Polymerase PCR buffer, 1 mM MgCl2, 0.2 mM dNTPs and 0.5 units of HotStarTaq DNA Polymerase (Qiagen, Doncaster, Australia). General cycle conditions were initial Taq activation at 95 °C for 15 min, followed by 30–35 cycles of 40-s denaturation at 95 °C, 40 s annealing at 54–57 °C and 45-s extension at 72 °C and a final extension at 72 °C for 10 min. A negative control with ddH2O replacing DNA was included in all PCR reactions. PCR products were visualised by electrophoresis on a 1 % agarose gel, purified with an UltraClean GelSpin DNA Extraction kit (Mo Bio, Calsbad, CA, USA) and directly sequenced by Macrogen sequencing services (South Korea) on a 3730XL DNA analyser (AB, USA) using BigDye v3.1 (AB, USA). Sequence chromatograms were aligned and edited using Sequencher® 4.9 (Gene Codes, Ann Arbor, MI, USA). A secondary peak at over 30 % of the primary peak height in the sequence chromatograms was considered evidence for presence of multiple nucleotides at that site.

Identification of exon 2 variants

Genetic material was obtained from 20 koalas from two free-living populations in areas known to have high genetic diversity from previous studies using neutral markers (Houlden et al. 1996): South East Queensland (n = 10) and the Port Macquarie region in the Mid-North Coast of New South Wales (n = 10). Genomic DNA (gDNA) was extracted from archived frozen blood, blood clots, buffy coats, the liver or spleen, using the Qiagen DNeasy Blood & Tissue kit and protocol (Qiagen, Doncaster, Australia), and then stored at −20 °C. Using exon 2 primers (Table 1) and PCR and sequence methods described above, exon 2 of each MHCII gene was amplified.

DAA and DBA amplicons were genotyped using single-strand conformation polymorphism (SSCP) (Orita et al. 1989), followed by direct sequencing, based on the protocol of Meyer-Lucht et al. (2008). Exon 2 amplicons from gDNA were denatured at 95 °C for 5 min, chilled rapidly on ice and then subjected to electrophoresis at 20 W for 5 h at 4 °C in an optimised 18 × 24-cm gel matrix consisting of 5 or 10 % total acrylamide (19:1 acrylamide/bisacrylamide), 5 % glycerol and × 0.5 Tris–borate–EDTA (TBE) buffer, polymerised using ammonium persulfate and N,N,N′,N′-tetramethylethylene-diamine. Gels were then stained with SYBR® Gold (Invitrogen, Mulgrave, VIC, Australia) and visualised by an ultraviolet illuminator. At least two representative koalas of each DAA or DBA “genotype pattern” were selected for direct sequencing to identify variants inferred from chromatograms of apparent homozygotes and heterozygotes.

Due to the large number of bands encountered on SSCP analyses of DAB and DBB, amplicons from these genes were subjected to one-strand conformation polymorphism (OSCP) (Miller et al. 2007). PCR and electrophoresis conditions were as described for SSCP, with the exception that the forward primers were 5′ phosphorylated, and following PCR, amplicons were digested with lambda exonuclease (New England BioLabs) to remove the forward strand of DNA. Representatives of all “genotype patterns” (11 and 9 koalas for DAB and DBB, respectively) were selected, and amplicons were cloned and sequenced using the TOPO TA Cloning® kit and pCR®2.1-TOPO® vector (Invitrogen, Mulgrave, VIC, Australia). To identify all MHCII variants in each koala, 15 to 20 positive clones were selected from each PCR and re-amplified and screened by SSCP analysis. At least three clones from each SSCP genotype pattern were cultured overnight in LB broth and then plasmid DNA purified using the UltraClean® Mini Plasmid Prep kit (Mo Bio, Calsbad, CA, USA) and sequenced. Additional clones were selected for purification and sequencing until all SNPs observed in the initial sequence chromatograms were accounted for. Further variant identification was performed by excision of single bands from the OSCP gel that were diluted in × 10 TBE, amplified in standard PCR using exon 2 primers and then sequenced.

A sequence variant was considered a true MHCII variant and included in the analyses when identified by direct sequencing, sequencing of excised OSCP band or molecular cloning, from two independent PCR reactions as recommended by Kennedy et al. (2002). The MHCII variants identified in this study were named using the gene prefixes (Phci), followed by the variant number corresponding to the MHC nomenclature suggested by Klein et al. (1990).

Data analysis

Phylogenetic relationships among DA and DB exon 2 sequences of the koala and other marsupials were examined by alignment of nucleotide and derived amino acid sequences using ClustalW and analysis using maximum likelihood (ML) method in RAxML (Stamatakis 2006) and Bayesian inference (BI) in MrBayes (Huelsenbeck and Ronquist 2001). The Akaike (AIC) Bayesian (BIC) information criterion used in ModelGenerator was used to determine a model of DNA substitution that fits the data set for phylogenetic reconstruction (Keane et al. 2006). For the alpha-chain sequences, the TVMef + G (0.94) model and K80 + G (0.95) was selected as the best-fit model based on the AIC and BIC, respectively. For the beta-chain sequences, the GTR + G (0.62) model and K81 + G (0.60) was selected based on the AIC and BIC, respectively. The TVMef model is not yet implemented in RAxML, thus we used the GTR + G model instead. Accession numbers for the alpha chain sequences used in the phylogenetic tree are brushtail possum TrvuDAA1 (EU500871), TrvuDAA2 (EU500874), TrvuDBA1 (EU500895), TrvuDBA7 (EU500901) and TrvuDBA11 (EU500905); red-necked wallaby MaruDAA (U18110) and MaruDBA (U18109) and common opossum ModoDAA (CH465496) and ModoDBA (XM_001376727.1). Accession numbers for the beta-chain sequences used are brushtail possum TrvuDAB1 (AF312030.1), TrvuDAB2 (AF312029.1), TrvuDAB3 (EU500880.1), TrvuDAB4 (EU500885.1), TrvuDBB1 (EU500908.1), TrvuDBB3 (EU500909.1), TrvuDBB4 (EU500910.1) and TrvuDBB5 (EU500911.1); red-necked wallaby MaruDAB1 (M81624.1), MaruDAB2 (M81626.1) and MaruDBB (M81625.1); tammar wallaby MaeuDBB01 (AY438038.1) and MaeuDBB02 (AY438039.1); Tasmanian devil SahaDAB2 (EF591103.1) and SahaDAB6 (EF591107.1); common opossum ModoDAB (NM_001032991.1); Brazilian gracile mouse opossum GrmiDAB1 (EU350150.1) and GrmiDAB46 (EU350196.1) and grey short-tailed opossum MainDAB1 (EU350142.1) and MainDAB2 (EU350143.1). Sequence from human DR (Hosa; NM_021983) was used as an out-group for all analyses. Topological support for the ML and BI was assessed according to the specific model of substitution with 1,000 non-parametric bootstraps and 1 × 108 MCMC steps (sampling every 10,000 steps and 1,000 burn-in steps), respectively, and neighbour-joining trees were formed using FigTree version 1.3.1 (Rambaut 2009).

Selection tests

MEGA 5.0 (Tamura et al. 2011) was used to calculate non-synonymous substitutions per non-synonymous site (dN) and synonymous substitutions per synonymous site (dS) with the modified Nei–Gojobori method and Jukes–Cantor adjustment and a transition/transversion ratio of 2. Codon-based Z tests with 1000 bootstrap replicates were used for testing neutral (dN ≠ dS), positive (dN > dS) and purifying (dN < dS) selection in koala DAB and DBB sequences independently. Due to the low variant diversity in the two alpha-chain MHCII genes of the koala, selection tests were conducted only on PhciDAB and PhciDBB variants. Although the branch-site method of identifying codon sites under positive selection (Zhang et al. 2005) is commonly used in MHCII sequence analyses, this was not pursued in this study based on recommendations by Hughes and Friedman (2008).

Results and discussion

MHCII genetic variation in the koala

We have identified a total of two PhciDAA, eight PhciDAB, three PhciDBA and five PhciDBB variants from two populations of koalas (Supplementary material C). SSCP analysis of the DAA exon 2 sequences from the 20 animals identified three genotype patterns (Fig. 1a). Direct sequencing indicated these were one heterozygote and two homozygote patterns, comprised of two DAA variants, designated PhciDAA*01 and PhciDAA*02 (GenBank accession numbers JX109917–JX109918). The two DAA variants were highly conserved, differing by only two synonymous substitutions (Fig. 2a, Supplementary material D). Similarly, SSCP analysis of DBA identified four genotype patterns (Fig. 1b), representing two homozygote and two heterozygote patterns, composed of three non-synonymous DBA variants, designated PhciDBA*01 to PhciDBA*03 (GenBank accession numbers JX109919–JX109921). These shared an average 91.4 and 93.6 % identity at the nucleotide and amino acid levels, respectively (Fig. 2b, Supplementary material D). The detection of no more than two DAA or DBA variants in any individual suggests that at least one locus of each alpha-chain gene was amplified.
https://static-content.springer.com/image/art%3A10.1007%2Fs00251-012-0658-5/MediaObjects/251_2012_658_Fig1_HTML.gif
Fig. 1

Genotype patterns from koalas screened by SSCP (a, b) or OSCP (c, d). Each lane corresponds to a representative of each genotype pattern. The caption represents the MHCII gene variants identified within each genotype pattern. There were fewer SSCP genotype patterns in the alpha-chain genes DAA (a) and DBA (b) compared to OSCP genotype patterns in the beta-chain genes, DAB (c) and DBB (d), due to higher number of variants in the beta chain. A single allele variant can produce multiple bands in SSCP and OSCP assays due to multiple conformations

https://static-content.springer.com/image/art%3A10.1007%2Fs00251-012-0658-5/MediaObjects/251_2012_658_Fig2_HTML.gif
Fig. 2

Multiple amino acid sequence alignment of marsupial alpha chain exon 2 variants. a Two koala synonymous DAA variants and b three koala DBA variants were identified. A potential glycosylation site and conserved amino acids are boxed. Dots indicate agreement with the top sequence in each alignment. Variant frequencies for South East Queensland (SQ) and Port Macquarie (PM) populations are given in italic

Using OSCP analyses and molecular cloning, we identified a total of eight DAB variants (GenBank accession numbers JX109927–JX109934), comprised of one new and seven previously described variants (Jobbins et al. 2012). Eight DAB OSCP genotype patterns (Fig. 1c) were identified among the 20 koalas studied, and molecular cloning confirmed that all koalas in this study have between three and five DAB variants, suggesting that the genome contains at least three DAB loci. The new variant, PhciDAB*24, and the seven previously described DAB variants, PhciDAB*10, PhciDAB*15, PhciDAB*18, PhciDAB*19, PhciDAB*21, PhciDAB*22 and PhciDAB*23 (Jobbins et al. 2012), share an average 91.1 % nucleotide identity and 83.0 % amino acid identity (Fig. 3a, Supplementary material D). The PhciDAB*10 and PhciDAB*15 variants differed by only one non-synonymous nucleotide substitution. A total of 51 polymorphic nucleotide sites were identified among the eight DAB variants, with 59 variations. Thirty-three codon positions contained polymorphisms; four of which were synonymous, and 29 were non-synonymous.
https://static-content.springer.com/image/art%3A10.1007%2Fs00251-012-0658-5/MediaObjects/251_2012_658_Fig3_HTML.gif
Fig. 3

Multiple amino acid sequence alignment of koala and marsupial beta-chain exon 2 variants. a Eight DAB and b five DBB variants were identified in this study, and all were non-synonymous. Conserved amino acid residues, the putative N-glycosylation motif (NGT) and the CD4-binding motif (RFDS) are boxed. Dots indicate agreement with the top sequence in each alignment. Variant frequencies for the two koala populations are given in italic

In a similar manner, ten different DBB genotype patterns were identified using OSCP analysis (Fig. 1d), and molecular cloning and sequencing of excised OSCP bands confirmed five PhciDBB variants. The DBB exon 2 variants, designated PhciDBB*01 to PhciDBB*05 (GenBank accession numbers JX109922–JX109926), are non-synonymous and share an average 90.7 and 87.3 % identity at the nucleotide and amino acid levels, respectively (Fig. 3b, Supplementary material D). A total of 40 polymorphic nucleotide sites, containing 45 variations among all five DBB variants, were found. Twenty-four codon positions showed variation, with one synonymous and 23 non-synonymous substitutions observed. Koalas possess at least one DBB locus, as the majority (95 %) of koalas studied had one to two PhciDBB variants.

Structure and frequency of MHCII variants

It appears likely that all MHCII loci amplified in this study are functional, based on identification of open reading frames or detection in mRNA or both (Supplementary material B). In addition, all variants identified in this study share high sequence identity with corresponding sequences in other marsupials and lack frame-shift mutations or premature stop codons, and the majority share most of the typically conserved essential amino acids and potential glycosylation sites (Slade and Mayer 1995). We did not amplify presumably degenerative ancestral atypical PhciDAB variants with multiple genetic lesions, previously found using macropod-specific primers (Jobbins et al. 2012). With the exception of three variants, all beta-chain sequences contained the essential conserved residues, the NGT glycosylation site, and the RDFS motif for CD4 binding which is usually highly conserved in mammals (Mazerolles et al. 1988; Brown et al. 1993). The significance of the change from arginine (R) to histidine (H) in the RFDS CD4 binding motif in the PhciDBB*05 variant of this study is uncertain. Unlike the atypical PhciDAB variants of Jobbins et al. (2012), which have a substitution to RFGR and several other significant genetic lesions, the remainder of the PhciDBB*05 variant appeared to be intact, similar to variants with similar mutations in other species, which also appear likely to be functional (Lillie et al. 2012; Meyer-Lucht et al. 2008). Mutations in the RFDS motif may hinder interaction with CD4+ T lymphocytes during antigen presentation, although determination of the functionality of such mutations is beyond the scope of these studies. Any possible functional impact of the PhciDBB*05 variant in this study is expected to be small as, due to its rarity, it was identified only in DBB heterozygotes. Other substitutions occurred in two of the five most common variants (Figs. 2 and 3): serine substituted for glycine in the NGT glycosylation site of PhciDBB*02 (found in 70 % of koalas), and the conserved tryptophan residue at position W61 was replaced with leucine in PhciDAB*19 (found in all koalas). W61 may be important for binding antigen peptides (Brown et al. 1993), and leucine substitution has been seen in other marsupials (Lam et al. 2001; Siddle et al. 2007); perhaps this variant provided the koala with advantage against specific historical pathogens and became common, suggesting that a mutation at W61 may not significantly impede antigenic binding.

Variant frequencies in the two populations also revealed a number of population-specific variants (Figs. 2 and 3). Five variants were limited to the Port Macquarie population, including PhciDAB*18, PhciDAB*22, PhciDAB*24, PhciDBB*03 and PhciDBA*02, and one variant, PhciDBB*05, was found only in the South East Queensland population. Investigation of additional koala populations in future studies would allow us to confirm whether such variants remain population specific and provide insights into whether local evolution of MHCII has occurred.

Comparison of MHCII phylogeny, variation and selection to other marsupials

Maximum likelihood and Bayesian analyses generated similar phylogenetic trees, based on the nucleotide sequences of koala MHCII exon 2 identified in this study and MHCII sequences from other marsupials (Fig. 4). All four koala MHCII genes formed well-supported clades with their marsupial counterparts, especially the Australidelphia. PhciDBB*01 and PhciDBB*02 formed a very well-supported clade, suggesting that the two variants are from the same DBB locus, while the PhciDBB*05 variant, with a non-synonymous substitution in the CD4 binding motif, clustered away from the four other DBB variants. Similarly, PhciDAB*10 and PhciDAB*15 clustered together, while clustering of the remaining six PhciDAB variants lack phylogenetic support, thus making it difficult to infer variants to specific DAB loci. Within DAB, we identified a significant support against neutrality (dN ≠ dS) and excess of non-synonymous over synonymous substitutions (dN > dS), indicative of positive selection (Table 2). However, no significant support against neutrality over the entire koala DBB sequences was detected (Table 2).
https://static-content.springer.com/image/art%3A10.1007%2Fs00251-012-0658-5/MediaObjects/251_2012_658_Fig4_HTML.gif
Fig. 4

Bayesian and maximum likelihood phylogenetic analyses of MHCII a alpha- and b beta-chain exon 2 nucleotide sequences of the koala compared to other marsupials. The percentages of supporting posterior probabilities and ML bootstrap values are displayed above and below, respectively, in boxes at each branch point

Table 2

Rates of non-synonymous and synonymous substitutions and Z tests for neutral, positive and purifying selection for the entire koala DAB and DBB exon 2 sequence

Gene

Substitution rate

Z test of neutral selection (dN ≠ dS)

Z test of positive selection (dN > dS)

Z test of purifying selection (dN < dS)

dN

dS

dN/dS

Statistic

P

Statistic

P

Statistic

P

DAB

0.115

0.050

2.30

2.662

0.009

2.756

0.003

−2.851

1.000

DBB

0.089

0.066

1.35

1.114

0.267

1.163

0.124

−1.133

1.000

Our study detected lower levels of MHC class II DAA, DAB and DBA allelic diversity and similar levels of DBB diversity in koalas and the New Zealand brushtail possum (Trichosurus vulpecula), although there is a comparable number of likely loci with at least one DAA, three DAB loci, two DBA and two DBB loci in T. vulpecula (Holland et al. 2008). The number of populations studied was greater for T. vulpecula, and indeed, population-specific variants found in the current study strongly suggest that additional variants may be identified as more koala individuals, and populations are studied. With this caveat in mind, however, the level of diversity detected within the two koala populations in this study was much less than that of single populations of the Brazilian gracile opossum (Gracilinanus microtarsus) (n = 54) in which 80 DAB variants were identified representing at least four DAB loci (Meyer-Lucht et al. 2008) and the tammar wallaby (Macropus eugenii) (n = 12) which contained 44 DBB variants representing minimum four DBB loci (Cheng et al. 2009).

In many species, low MHCII diversity is often associated with increased parasite burdens or disease; for example, high pathogen burdens associated with low population-wide DAB diversity have been identified in the grey slender mouse opossum (Marmosops incanus) (Meyer-Lucht et al. 2010). This may be the case for koalas, or alternatively, the low MHCII diversity may be a reflection of the lack of pathogen-driven selection, due to low pathogen loads (Sommer 2005). This might stem from the presence of a dominant disease process, such as chlamydiosis, or may be associated with the solitary lifestyle of the species, which might limit repeated exposure to pathogens and therefore diminish the selective pressure for adaptive immunity.

This study is the first to characterise variation in koala DAA, DBA and DBB MHCII genes and provided locus-specific primers for DAB. In comparison to alpha-chain genes, we found higher diversity at the two beta-chain genes (DAB and DBB), making them suitable candidates for future investigations of the role of MHC in disease susceptibility. This work was carried out on koalas from populations with high microsatellite diversity. Future studies will focus on MHC diversity in southern populations, known to have low diversity at microsatellite markers.

Acknowledgments

This research was funded by the Hermon Slade Foundation. All procedures were approved by the University of Sydney Animal Ethics Committee (AEC N00/4-2005/3/4088, AEC N00/5-2009/1/4829).We acknowledge Weerachai Jaratlerdsiri and Simon Ho for their help with analyses, Jaime Gongora for guidance on the manuscript and Joanna Griffith and all staff at the koala hospitals for sample collection.

Supplementary material

251_2012_658_MOESM1_ESM.pdf (792 kb)
ESM 1(PDF 792kb)

Copyright information

© Springer-Verlag Berlin Heidelberg 2012