Theoretical and Applied Genetics

, Volume 120, Issue 7, pp 1415–1441

Integration of novel SSR and gene-based SNP marker loci in the chickpea genetic map and establishment of new anchor points with Medicago truncatula genome

Authors

  • Spurthi N. Nayak
    • Centre of Excellence in Genomics (CEG)International Crops Research Institute for the Semi-Arid Tropics (ICRISAT)
    • Department of GeneticsOsmania University
  • Hongyan Zhu
    • Department of Plant PathologyUniversity of California
    • Department of Plant and Soil SciencesUniversity of Kentucky
  • Nicy Varghese
    • Centre of Excellence in Genomics (CEG)International Crops Research Institute for the Semi-Arid Tropics (ICRISAT)
  • Subhojit Datta
    • Department of Plant PathologyUniversity of California
    • Indian Institute of Pulses Research
  • Hong-Kyu Choi
    • Department of Plant PathologyUniversity of California
    • Department of Genetic EngineeringDong-A University
  • Ralf Horres
    • University of Frankfurt
  • Ruth Jüngling
    • University of Frankfurt
  • Jagbir Singh
    • Centre of Excellence in Genomics (CEG)International Crops Research Institute for the Semi-Arid Tropics (ICRISAT)
    • Department of Agricultural BiotechnologyAcharya N.G. Ranga Agricultural University (ANGRAU)
  • P. B. Kavi Kishor
    • Department of GeneticsOsmania University
  • S. Sivaramakrishnan
    • Department of Agricultural BiotechnologyAcharya N.G. Ranga Agricultural University (ANGRAU)
  • Dave A. Hoisington
    • Centre of Excellence in Genomics (CEG)International Crops Research Institute for the Semi-Arid Tropics (ICRISAT)
  • Günter Kahl
    • University of Frankfurt
    • GenXPro GmbH, Frankfurter Innovationszentrum Biotechnologie (FIZ)
  • Peter Winter
    • GenXPro GmbH, Frankfurter Innovationszentrum Biotechnologie (FIZ)
  • Douglas R. Cook
    • Department of Plant PathologyUniversity of California
    • Centre of Excellence in Genomics (CEG)International Crops Research Institute for the Semi-Arid Tropics (ICRISAT)
    • Genomics Towards Gene Discovery Subprogramme, Generation Challenge Programme (GCP)CIMMYT
Open AccessOriginal Paper

DOI: 10.1007/s00122-010-1265-1

Cite this article as:
Nayak, S.N., Zhu, H., Varghese, N. et al. Theor Appl Genet (2010) 120: 1415. doi:10.1007/s00122-010-1265-1

Abstract

This study presents the development and mapping of simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) markers in chickpea. The mapping population is based on an inter-specific cross between domesticated and non-domesticated genotypes of chickpea (Cicer arietinum ICC 4958 × C. reticulatum PI 489777). This same population has been the focus of previous studies, permitting integration of new and legacy genetic markers into a single genetic map. We report a set of 311 novel SSR markers (designated ICCM—ICRISAT chickpea microsatellite), obtained from an SSR-enriched genomic library of ICC 4958. Screening of these SSR markers on a diverse panel of 48 chickpea accessions provided 147 polymorphic markers with 2–21 alleles and polymorphic information content value 0.04–0.92. Fifty-two of these markers were polymorphic between parental genotypes of the inter-specific population. We also analyzed 233 previously published (H-series) SSR markers that provided another set of 52 polymorphic markers. An additional 71 gene-based SNP markers were developed from transcript sequences that are highly conserved between chickpea and its near relative Medicago truncatula. By using these three approaches, 175 new marker loci along with 407 previously reported marker loci were integrated to yield an improved genetic map of chickpea. The integrated map contains 521 loci organized into eight linkage groups that span 2,602 cM, with an average inter-marker distance of 4.99 cM. Gene-based markers provide anchor points for comparing the genomes of Medicago and chickpea, and reveal extended synteny between these two species. The combined set of genetic markers and their integration into an improved genetic map should facilitate chickpea genetics and breeding, as well as translational studies between chickpea and Medicago.

Introduction

Chickpea (Cicer arietinum L.) is an annual, self-pollinated diploid (2n = 2x = 16) species with a relatively small genome of 740 Mbp (Arumuganathan and Earle 1991). Chickpea is also the World’s third most widely grown food legume. Over 95% of chickpea production area and consumption occur in developing countries, with India contributing the largest share (65%), followed by Pakistan (9%), Iran (7%), and Turkey (4%) (FAOSTAT database http://faostat.fao.org/site/567/default.aspx#ancor, 2007). Cytogenetic and seed protein analyses are consistent with C. reticulatum as the wild progenitor of domesticated C. arietinum, with southeastern Turkey as the presumed center of origin (Ladizinsky and Adler 1976). Cultivated chickpea is composed of two genetically distinct sub-types that are readily distinguished based on seed size and color: Desi, composed of small, brown seeded varieties, and Kabuli, composed of large, cream seeded varieties. Due to relatively low rates of polymorphism between cultivated chickpea accessions, inter-specific crosses between C. arietinum and C. reticulatum have been the primary focus for genetic studies of agronomic traits (see Singh et al. 2008).

A diverse array of technologies is available to identify and monitor DNA polymorphism and as a consequence molecular markers are now routinely used in the breeding programs of several crop species (Varshney et al. 2006, 2007). In the case of chickpea, molecular markers reported in the literature are almost entirely simple sequence repeat (SSR) loci (Choudhary et al. 2006; Hüttel et al. 1999; Lichtenzveig et al. 2005; Sethy et al. 2003, 2006a, b; Winter et al. 1999). Despite considerable effort, low rates of both intra- and inter-specific polymorphism have limited the number of these SSR markers that have been integrated into chickpea genetic maps. A primary goal of the current study was to screen additional molecular markers and thereby enhance the marker density of chickpea genetic maps.

Chickpea is a close relative of the model legume system Medicago truncatula (Fig. 1, reproduced according to Choi et al. 2004b), and thus should benefit from the increasingly detailed description of the structure and function of the M. truncatula genome (Cannon et al. 2006). A pressing task for chickpea researchers is to use knowledge gained from the study of reference legumes, such as M. truncatula, Lotus japonicus, and soybean, to advance genetic improvement of chickpea. Comparative genomics based on orthologous genetic markers offers means to bridge model and crop legumes. Alignment of linkage maps and sequenced orthologous regions between several legume species has revealed an extensive network of macro- and micro-synteny between legume species; importantly, genomic and genetic comparisons of orthologous nodulation genes in several legumes suggests that comparison of genome structure and function may have practical applications to cross-species gene prediction and isolation (see Zhu et al. 2005). The lack of infrastructure (knowledge and physical capacity) in chickpea, however, has limited the potential for cross-genome comparisons and has hampered progress in the area of genomics-assisted breeding (Varshney et al. 2009a).
https://static-content.springer.com/image/art%3A10.1007%2Fs00122-010-1265-1/MediaObjects/122_2010_1265_Fig1_HTML.gif
Fig. 1

Phylogenetic relationships: Papilionoideae family. This figure (taken from Choi et al. 2004b) illustrates the phylogenetic relation of chickpea with other legumes. Chickpea and Medicago belong to inverted repeat lacking clade (IRLC) of Papilionoideae and constituted the cool season legumes

In view of the above, we sought to enhance marker repertoire and density of genetic maps in chickpea using a combination of several molecular marker sets. We developed two novel sets of molecular markers based on an SSR-enriched genomic DNA library and gene-based single nucleotide polymorphism (SNP) markers derived from comparison of Medicago and chickpea ESTs. These novel genetic markers were analyzed together with published genetic markers to develop a dense genetic map of chickpea. We anticipate that these resources will serve as tools for genomics-assisted breeding in chickpea, and enhance prospects for transfer of knowledge about the structure and function of the Medicago genome to chickpea with a final objective of chickpea improvement.

Materials and methods

Plant material and DNA extraction

The cultivated chickpea germplasm line ICC 4958, belonging to Desi type and a parent line of inter-specific reference mapping population (C. arietinum ICC 4958 × C. reticulatum PI 489777) was used to construct microsatellite-enriched library. While two genotypes of chickpea (ICC 4958 and ICC 1882) were used to optimize the polymerase chain reaction (PCR) conditions for newly developed SSR markers, an array of 48 genotypes which includes 33 genotypes from cultivated chickpea (C. arietinum) and 15 from wild species of chickpea (7 genotypes from C. reticulatum, 2 genotypes from C. echinospermum and one each from C. bijugum, C. cuneatum, C. judaicum, C. microphyllum, C. pinnatifidum, and C. yamashitae) was used to assess the polymorphism potential of new set of SSR markers (Table 1).
Table 1

List of 48 chickpea genotypes used for calculating polymorphic information content (PIC) of newly developed SSR markers

S No.

Genotype

Botanical variety

Country of origin

Market type

1

ICCV 2

C. arietinum

India

Kabuli

2

ICC 10673

C. arietinum

Turkey

Desi

3

ICC 11944

C. arietinum

Nepal

Desi

4

ICC 12299

C. arietinum

Nepal

Desi

5

ICC 12379

C. arietinum

Iran

Desi

6

ICC 1431

C. arietinum

India

Desi

7

ICC 17116

C. yamashitae

Afghanistan

Wild

8

ICC 17122

C. bijugum

Turkey

Wild

9

ICC 17123

C. reticulatum

Turkey

Wild

10

ICC 17148

C. judaicum

Lebanon

Wild

11

ICC 17152

C. pinnatifidum

Turkey

Wild

12

ICC 17160

C. reticulatum

Turkey

Wild

13

ICC 17162

C. cuneatum

Ethiopia

Wild

14

ICC 17248

C. microphyllum

Pakistan

Wild

15

ICC 1882

C. arietinum

India

Desi

16

ICC 2679

C. arietinum

Iran

Desi

17

ICC 283

C. arietinum

India

Desi

18

ICC 3137

C. arietinum

Iran

Desi

19

ICC 3239

C. arietinum

Iran

Desi

20

ICC 3696

C. arietinum

Iran

Desi

21

ICC 3986

C. arietinum

Iran

Desi

22

ICC 4853

C. arietinum

Unknown

Kabuli

23

ICC 4958

C. arietinum

India

Desi

24

ICC 5002

C. arietinum

India

Desi

25

ICC 506 EB

C. arietinum

India

Desi

26

ICC 5337

C. arietinum

India

Kabuli

27

ICC 6263

C. arietinum

Russia and CISs

Kabuli

28

ICC 7052

C. arietinum

Iran

Desi

29

ICC 7413

C. arietinum

India

Pea

30

ICC 8200

C. arietinum

Iran

Desi

31

ICC 8261

C. arietinum

Turkey

Kabuli

32

ICC 9644

C. arietinum

Afghanistan

Desi

33

ICC V95311

C. arietinum

India

Kabuli

34

JG11

C. arietinum

India

Desi

35

JG62

C. arietinum

India

Desi

36

VIJAY

C. arietinum

India

Desi

37

IG 72933

C. reticulatum

Turkey

Wild

38

IG 72953

C. reticulatum

Turkey

Wild

39

PI 489777

C. reticulatum

Turkey

Wild

40

IG 10419

C. arietinum

Syria

Kabuli

41

IG 6044

C. arietinum

Sudan

Kabuli

42

IG 6899

C. arietinum

Iran

Kabuli

43

IG 7148

C. arietinum

Algeria

Kabuli

44

IG 72971

C. reticulatum

Turkey

Wild

45

IG 73064

C. echinospermum

Turkey

Wild

46

IG 73074

C. echinospermum

Turkey

Wild

47

IG 73082

C. reticulatum

Turkey

Wild

48

IG 7767

C. arietinum

Syria

Kabuli

For integrating the markers into the genetic map, the inter-specific reference mapping population ICC 4958 × PI 489777 comprising of a total of 131 RILs was used. While all 131 RILs were used to score genotyping data for the SSR markers isolated in this study as well as reported by Lichtenzveig et al. (2005), a subset of 94 RILs was used with gene-based markers.

Total genomic DNA was extracted by employing the standardized high throughput mini DNA extraction protocol (as mentioned in Cuc et al. 2008). The quality and quantification of extracted DNA was checked on 1.2% agarose. The DNA was normalized to 5 ng/μl for further use.

Construction of SSR-enriched library

To construct a size-fractioned chickpea genomic DNA library, purified genomic DNA (100 μg) of ICC 4958 was completely digested with MboI or Sau3AI in combination with TaqI enzyme. The restricted fragments were separated on low-melting agarose gels, and the gel zone containing the fragments of DNA of size 800–1200 bp were excised and ligated into Promega pGEM 3Z(f) vector (Promega, Madison, WI, USA). The vector was transformed into E. coli Sure strain—DH10B (Stratagene, Heidelberg, Germany) by electroporation. Approximately 400,000 clones were plated at a density of 20,000 colonies per plate. The masterplates generated were replica-plated on positively charged PVDF macroarrays. Macroarrays were printed using contact printing technology at RZPD GmbH, Berlin, Germany.

For enriching the genomic DNA library, synthetic oligos (GA)10 and (TAA)10 were enzymatically 3′ end-labeled with digoxigenated oligonucleotides (DIG Oligonucleotide 3′-End Labeling Kit; Roche, Mannheim, Germany). Subsequently, macroarrays/filters were hybridized with above-mentioned oligo-probes in Roti-Hybri-Quick buffer (Carl Roth GmbH, Karlsruhe, Germany) including 10 μg/ml sheared, denatured E. coli DNA to minimize non-specific binding. Filters were hybridized at 55°C overnight and washed three times each for 10 min in 1:2, 1:5, and 1:10 dilutions of the hybridization buffer at 60°C. The digoxigen was detected in a “direct detection assay” performed with the DIG Wash and Block buffer set, and DIG Luminescent detection Kit (Roche, Mannheim, Germany) for chemiluminescent detection with a monospecific antibody coupled to alkaline phosphatase in the presence of CSPD. Filters were exposed to X-ray films (Amersham, Buckinghamshire, UK) with intensifying screens for 4 h or overnight, and the colonies giving strong signals were scraped from the master plates; re-grown; spotted on Hybond N membranes (Amersham, Buckinghamshire, England) to fix the DNA by lysis. Hybridization and chemiluminescent detection was done repeatedly to pick the clones with positive signals. These clones were grown on LB agar plates with ampicillin (100 μg/ml) overnight at 37°C. Aliquots of these colonies were used for colony PCR.

Development of genomic SSR markers

The colonies with high level of signal were used to isolate plasmid DNA using standard alkaline lysis method (Sambrook and Russell 2001). After checking the quality of the plasmid DNA on 0.8% agarose gel, the clones were sequenced using the BigDye Terminator cycle sequencing kit on an ABI3700/ABI3730XL (Applied Biosystems Inc., Foster City, CA, USA). 288 clones were sequenced in both directions using standard T7 promoter and SP6 primers and 19 clones in one direction by using M13-forward sequencing primer at Macrogen (www.macrogen.com) and ICRISAT.

The sequences generated were subjected to CAP3, a contig assembly program (http://pbil.univ-lyon1.fr/cap3.php) in order to define unigenes. These unigenes were subjected to MIcroSAtellite (MISA, Varshney et al. 2002) tool to search microsatellites considering minimum ten repeat units of mono- (N), and four repeats of di- (NN), tri- (NNN), tetra- (NNNN), penta- (NNNNN) and hexa- (NNNNNN) nucleotides and compound microsatellites present within a distance of 100 bp. Primer pairs for SSRs were designed using Primer3 program (http://frodo.wi.mit.edu/) in batch file, and the SSR markers developed were designated as ICCM (ICRISAT Chickpea Microsatellite) markers (Table 2).
Table 2

Simple sequence repeats (SSR) isolated from microsatellite-enriched library of chickpea

Marker name

GenBank ID

SSR motifa

Forward primer (5′–3′)

Reverse primer (5′–3′)

Product size (bp)

Number of allelesb

PIC value

ICCM0001a

FI856656

(AT)5

GAACTTGCTTGGGGACAGG

GAGGTGAGCTGAAGTGAGGC

246

2

0.05

ICCM0001b

FI856656

(CT)4tc(CT)4

TGCACAACGGCTATGTCTTC

GAGGTGAGCTGAAGTGAGGC

118

9

0.71

ICCM0002

FI856654

(TC)6

TCGTTCTCCGTTATGTGTGC

ATGCCTCCAATAGCATACGG

262

2

0.04

ICCM0003

FI856538

(CT)6

AATGGAAGAACGTCAGGGTG

TTCCACTGGGGCAAAATAAG

252

7

0.59

ICCM0004

FI856539

(AT)4

CACTCACACACGCACTTTCA

AAAAGAGAAGCCCACCAAAA

213

4

0.39

ICCM0005a

FI856657

(TC)4N(CT)4N(TC)4

TGCTGAGCGATCTGAGGATA

GCAGCAAAAATCAGCACAAA

277

NA

 

ICCM0005b

FI856657

(AT)4

TTGGTGCAGATTTTTGTTGC

AGATTTGGGGGATAAAAGGG

241

1

0.00

ICCM0007a

FI856661

(CTC)4N(TC)4N(TC)4

TCTACATTCTCTCCGTGCCC

GAGGAGTGTAGGGGAGAGGG

242

NA

 

ICCM0007b

FI856661

(TCCTC)4

CTCTCCCCACTCTCCCTTTC

TGAGTAGGATCGTAGTAGGGGG

202

NA

 

ICCM0008a

FI856540

(A)10N(A)10

CTCATGGTGGCATTGAGAAA

TCCTTGAATTTTTGAGACACGA

230

2

0.05

ICCM0008b

FI856540

(GA)4N(AG)5t(GA)4

TCGTGTCTCAAAAATTCAAGGA

CACTCGACCACCACTGCTAA

235

2

0.32

ICCM0008c

FI856540

(CT)4

GGTGGTTTGTGGAGGTTGAT

AGGCAACCATTCATCCTTGT

245

2

0.05

ICCM0009a

FI856541

(GA)4

CACTTCAAAAGAGTGTTTGATTTGA

GGTTTGAAAGATGAGTGGTTTTG

189

3

0.10

ICCM0009b

FI856541

(A)11

AAAATATGGAAAGTCGGGCA

TGCATTTTCTTAGCGGTTTTT

257

NA

 

ICCM0010a

FI856663

(CT)4

GACGGAAATACGGCTGGTTA

GCTGCAATATACTCCGCCTC

113

1

0.00

ICCM0010b

FI856662

(AT)4

ACGCCAATTCTTTTGAGCAC

TCAGCACTGGTGGAACCATA

142

12

0.80

ICCM0014a

FI856542

(GA)5

CGTGGTTGTGTTGTTTGAGG

TGTGTTCATCTCCCTCTCCC

134

1

0.00

ICCM0014b

FI856542

(TA)5

TTTGGGAACCTTTCTCATCAA

CCAAATCATTTTTGTGCACTG

254

3

0.16

ICCM0019a

FI856544

(AG)18

TTCCGGTTGTTGAGTAGAGAAA

ACTTCCACTTGTTCCATCCG

189

NA

 

ICCM0019b

FI856544

(AG)4

CGGATGGAACAAGTGGAAGT

TCTCGTACCGGACCAGAGTC

153

6

0.62

ICCM0021a

FI856697

(CA)4N(AT)4N(ATT)5

AAACCGCATTGAGGAATGAC

TTTGCCACGATATGTTCAGG

232

NA

 

ICCM0021b

FI856696

(AT)4

TCTTTCTAAGCAGTCTAGGATACGA

AGGAAGGGTGGGATAATTGG

229

NA

 

ICCM0022

FI856699

(AT)4

TAAACCGCATTGACGAATGA

TGAATTCGCAAGAATCAAATG

123

18

0.89

ICCM0024

FI856545

(AT)4

CACTCACACACGCACTTTCA

AAAAGAGAAGCCCACCAAAAA

214

3

0.08

ICCM0026

FI856714

(AG)4

CCGGACATTGTTCTGAAGGT

TCTGTGCAGTGGAGCTATGG

216

2

0.05

ICCM0029

FI856721

(AG)4N(GA)4N(GA)4a(AG)5

CTTCCCCTTTCCAAAATTGA

TCGTTCACAGGTTTTCCCTC

244

1

0.00

ICCM0030a

FI856722

(TC)4N(CT)4N(TC)4

GGCAACGTACGGGATAAATG

GCAGCAAAAATCAGCACAAA

271

1

0.00

ICCM0030b

FI856722

(T)10

TTGCTGCTGATTTTTGTTGC

TCATCCATCATTCTAAATGTGTCA

257

3

0.09

ICCM0032

FI856546

(GA)4

TCTCTTGACACAAGTCTGCACAT

CCCACTCACATGTAGCGAAA

232

1

0.00

ICCM0034

FI856651

(GA)11

TTTGTTTGCGGAGGAATAGG

TCACCTCACCACACTTCTTTTC

259

6

0.33

ICCM0035

FI856547

(GT)4

TGAGGGTAAATAAATTGGTGGC

ATGATTTCCGAGGACAGTGG

101

1

0.00

ICCM0037

FI856548

(AG)4N(GA)4N(AG)4N(GA)5

CAAGCAATGGGAGACACCTT

CCACCACTTCAACGTCTCCT

212

NA

 

ICCM0042

FI856740

(CA)4

TTCGTGATATTCATCAAGGTGG

TTTGACGTACTCTGTGTTTTGTTT

259

3

0.08

ICCM0043

FI856552

(GA)6

AAGATTGGATTCCACAACGC

ACAACCCACCCACACAAAC

274

7

0.44

ICCM0045

FI856553

(TA)4N(TC)12

TGAATCCCTCAATCCTGTGG

CTTATCTCCCCAGTTGCCAG

272

5

0.31

ICCM0052

FI856768

(TAT)6

CGTCGTGTCCATCTGTCTTG

CCAGGTGCAATAGGGAAATC

275

2

0.04

ICCM0053

FI856771

(GA)32t(AG)4

TGCGGTCGACTCTAGAGGAT

CTGAGAAGGAAGCCAACAGG

173

1

0.00

ICCM0059a

FI856779

(GAA)4

CGGTCGATCTGAGGATCACTA

GGGTTCAACTGTTCAGGTTTG

226

NA

 

ICCM0059b

FI856779

(AG)4N(GA)9N(GA)4

CAAACCTGAACAGTTGAACCC

AGGTTCTCCCTCGCTCTCTC

172

3

0.23

ICCM0060

FI856780

(AT)4N(CT)4

TGATGAACATGCTAACAAACTAACAA

CCAAGACAACTGGTGGAGGT

260

2

0.04

ICCM0061

FI856798

(AT)6N(TTA)4(TAA)4N(TTA)13

ATGCGGTAATCCTTGACTGG

TGAAATTGGGTTGGAAGTTTG

275

5

0.23

ICCM0062

FI856801

(AAT)4N(AAT)6

ATGCAACGCCTAAGTCTCGT

TAGGTACGTTTGGGGTCCTG

266

3

0.09

ICCM0063

FI856802

(TTA)6

TTGATTTATCCTGTGATGCTTTTT

GGCAGTCTGGTCATGTGAAA

194

2

0.04

ICCM0065a

FI856807

(TC)6

CATTCCCGCAAAGCTTGTAT

GGTGCCTTGGAGAAAATCAA

137

NA

 

ICCM0065b

FI856807

(TC)4

CACGGTGTCTTCCACATGAC

TAAGCCAATACCAAGAGGCG

195

2

0.08

ICCM0066

FI856555

(TC)4

ACCATGCTCACCAACTCACA

TCTCTTGACACAAGTCTGCACAT

242

1

0.00

ICCM0067

FI856556

(TC)4

AACTGCAACCTCTCTCGCTC

TCTCTTGACACAAGTCTGCACAT

204

1

0.00

ICCM0068

FI856557

(ATT)22

TCTTCTTTGCTATCTGTCTCGC

TGCATGTCAAACATTAGACAACTTT

227

14

0.87

ICCM0069

FI856558

(ATT)22

TCTTCTTTGCTATCTGTCTCGC

TGCATGTCAAACATTAGACAACTTT

227

13

0.82

ICCM0072

FI856813

(GAA)4

CAAGACCTTGAACAGGAGGC

TCTTTCAATTTTCTAACAATTTCATC

200

2

0.14

ICCM0073a

FI856828

(TA)4N(A)11N(TA)4

TCGATCTGAGGATCTTTGGTG

TGGATACTATTAACGAAAAACTAGCG

219

6

0.23

ICCM0073b

FI856828

(TC)4

CTTGTCCACCCCACATTCTT

TAGAGAAATGGGGGAAGGGT

217

1

0.00

ICCM0074a

FI856830

(A)11N(TC)6

AAATCCCAAATTTAGAGCGG

AACCTTTGAAAAAGGCGGTT

183

9

0.40

ICCM0074b

FI856830

(T)15

AACCGCCTTTTTCAAAGGTT

CCTTCCAGGGGAAAAAGAAA

264

NA

 

ICCM0075

FI856559

(AG)16

CTTTGTAACAATAAAATGCAAAGTAAA

GGAAGCACAGTCTGCACAAA

163

4

0.26

ICCM0076

FI856560

(ATA)17N(TAA)5

CTCATCGAATAGAACCTACCGA

CCGCTACACCTACAACGGTAA

270

3

0.08

ICCM0077a

FI856561

(AG)4N(T)10

CCACAAGAAGACAAAGGGGA

AAAAAGATGCTAAAACTAAACCAAAGA

217

1

0.00

ICCM0077b

FI856561

(A)10

GCCGAGAAAATAAATTTCACCA

GCCGCGACCATTAATTCTAA

124

2

0.04

ICCM0078a

FI856832

(TAT)4 g(ATT)6ag(TAT)5N(AT)4

CTGAGGACGTTGGGAATACG

AAAAACTAATCTCGTGTTCAAATCC

280

3

0.22

ICCM0078b

FI856832

(TC)4

AATCCCAACGGTGAGAGATG

GGACAAGGAGTGGAAGGGA

279

15

0.62

ICCM0079

FI856562

(TTA)6

GAGCTAACGCCTTCGCTAGA

GAGAGGGATTAAAACAAATAGAGGAA

170

3

0.08

ICCM0080

FI856563

(T)10

CTGCGGTGACTCTGAGGAT

GAGAATCACGGGTGTTTCAAG

173

3

0.15

ICCM0081

FI856564

(TAA)6

GAGAGGGATTAAAACAAATAGAGGAA

GAGCTAACGCCTTCGCTAGA

170

3

0.08

ICCM0082

FI856833

(CT)19N(TC)4

TCACGATCTCACAGAGCCAC

TCCGTGATTCTGAGCAACAG

260

3

0.08

ICCM0083a

FI856835

(AT)4N(CT)7

CGCTCACACCATCTCACTTC

GAATGGAGGAAATACAGAGTGC

273

NA

 

ICCM0083b

FI856837

(A)13

ATTGAAAAACCACGCACACA

AGCGACGACAGTGACCTTCT

140

1

0.00

ICCM0083c

FI856837

(T)11

TGTTTGTTGCCTAGCCACTG

TTGGACAGATTTTTGTTGTTTGTT

195

1

0.00

ICCM0084

FI856993

(GA)5

TTTTGATTGAGCATGCAATGT

GAACCTTTTGAGGTCTGTTGC

246

2

0.04

ICCM0085

FI856855

(T)10N(TAT)14

GTGGTCCATCTGTCTCGGTT

GGAAAAGGAGAAAGTTGTGGG

210

NA

 

ICCM0086a

FI856856

(TA)4N(T)11

TGTGCATTGAGCCTATTGGT

GACAACAGCGGCATAATCAA

182

NA

 

ICCM0086b

FI856856

(AC)4

CTTCCCCTTTACCCCGTTTA

AAAGAAATCGACAATAAAAGAGTGA

175

NA

 

ICCM0088

FI856861

(T)10N(AT)5

AAAGGAAGGGAAGGAAATGC

GAGTTTGGGCAGGCAATAAA

240

2

0.19

ICCM0089a

FI856863

(A)12

AACACCGACTTTCCAAAACG

TTTGGGAAATACAACCTTTGAA

204

9

0.45

ICCM0089b

FI856862

(TAT)20

GGGATATCGCCAATATATTTTATACC

TTTGGCAACAAATCCTTTGA

126

NA

 

ICCM0090a

FI856864

(TTA)6

ACGGGACTTGGATGACTTTC

AGACGCGTGCTTTCTTCCTA

257

NA

 

ICCM0090b

FI856864

(TC)5

CTGCCTAGGAAGAAAGCACG

AAAATAAATGCGCCGTATGC

160

3

0.39

ICCM0093a

FI856871

(TAT)20

CTTCTGTTATTATCGCCGCC

AGCATCATGGAGCAGAGAGG

223

NA

 

ICCM0093b

FI856871

(AT)4

TACCCTTTCTCTCCCCACCT

TCAGTAGTCGGGCAATAGATGA

129

NA

 

ICCM0093c

FI856870

(AAAT)4

CCACTTTTAGGCGCACTTCT

CGACTCATTTTTCACGGACA

197

3

0.24

ICCM0094

FI856872

(AT)4

AGAGGCAAACAAGAACCGAA

AAGGGTTAGTGGAGGAATTATGAA

279

3

0.08

ICCM0095a

FI856875

(TC)4

CTCTCCATCCCATCCGACTA

GGAAGCCATATCCAGAGGGT

181

NA

 

ICCM0095b

FI856874

(ATTC)4

CGGGACATTTCCGTTAAAAA

CGAGTCGTTTTCTTGGCTTC

171

1

0.00

ICCM0096

FI856877

(AT)4N(CT)4N(TC)4

ACACCCCACCCTAATTACACT

GAGAGGTACGAAGCACGAGG

170

9

0.47

ICCM0097a

FI856669

(ATT)12N(TA)4

TGAGGACTGCCATACTCCAG

TCCCCTTTATGAGGGCTTTT

276

3

0.09

ICCM0097b

FI856668

(CTT)4

TCCAATTCCAAAACACACCA

CCTGAGGAGTAAAAGACGGG

130

1

0.00

ICCM0101a

FI856675

(A)13

TAACTGAGTTTCGGGTTCCG

CTTAACGGACGTTGTAGGGC

247

NA

 

ICCM0101b

FI856674

(AG)4

GAAGACAAAAAGGGGCACAA

CCGATTGTTTCAAGACCAGA

105

2

0.04

ICCM0102

FI856676

(T)12

CACCAAAAAGGGAACTTTCG

AAAAATAGGGTGGGGAGGG

167

1

0.00

ICCM0103

FI856678

(A)11

ATGGGGGAATCGGAGACTAA

GGATAGGGAGGAGGGAACAG

110

3

0.18

ICCM0104

FI856566

(TTA)11

CCAAACCTCCAAAAATCTGC

TCATTTTTGATTCATTCTTGGG

278

8

0.48

ICCM0105

FI856567

(AT)4

TGCTTCCTTTTCAATCACCA

TGACAAAGGACAAATAAGTGTTTTA

280

1

0.00

ICCM0106

FI856681

(ATA)7

TGGAATTGCTACCGAATATGG

ACGATCGGAGAGAACGAGAA

267

NA

 

ICCM0107a

FI856682

(TCG)4

GCAAAAAGTGTTGCTTCCGT

AAGCACATTGCCACTAGCAT

234

1

0.00

ICCM0107b

FI856682

(TA)4

GCAAAAAGTGTTGCTTCCGT

AAGCACATTGCCACTAGCAT

234

3

0.16

ICCM0110

FI856568

(AT)4N(TTA)7

AGAGGCAAACAAGAACCGAA

GTAAAGAGGGGCAGCTGTTG

183

NA

 

ICCM0115

FI856706

(TC)4

ACCCTAAGGGCTCGTTTGAT

TAGGGATGGAGAGGAGAGCA

245

1

0.00

ICCM0116

FI856709

(T)11

TTTTGGTGCAAGAGAATGGG

GTCTTTCAAGAGGTCGCAGC

177

1

0.00

ICCM0117

FI856572

(TAA)4

AGTGACCAGGAAACACGGTC

GCAGAGATTGAATTTTGCCA

254

1

0.00

ICCM0118

FI856573

(T)11

AATTGGGAAGGAAAGCGAGT

TCGCCATTGCAATAATCAAA

279

NA

 

ICCM0119

FI856710

(GA)4

TTATTGGATGAGTGGATGCG

ATTACGTAACCCAACGTCGC

192

NA

 

ICCM0120a

FI856574

(TTA)12

TGTCTCGATAAGAGTTTGTTATTTTTC

CGTTTTGTTTCATATTCAAACTCG

220

12

0.75

ICCM0120b

FI856574

(ATT)13

CGAGTTTGAATATGAAACAAAACG

GCTTGTAGCTAGGCTCGACTC

166

5

0.29

ICCM0121a

FI856575

(TATT)4

CAAAAATTTGGATTCGGGAG

CTATTGCACCTGGGGATACG

238

2

0.09

ICCM0121b

FI856575

(A)10N(ATA)17

ACGTATCCCCAGGTGCAATA

AACAGATGTAGAAGGTATAATCCATGA

224

1

0.00

ICCM0122

FI856576

(AAT)4

GCAACCTGCCATCCATACTT

AGTGAATCAAATGATGAAAGCA

275

1

0.00

ICCM0123a

FI856577

(TTA)14

GGATGGTCTGCTGGAATCAT

AAAGACAACAAAAAGACAATCATGT

250

9

0.76

ICCM0123b

FI856577

(TAA)26

TTTTTACATGATTGTCTTTTTGTTG

TGAGGACTAAGATAATAGCAATCCAA

201

NA

 

ICCM0124

FI856578

(AAT)4aaa(AAT)4

CCTCGGGAATTCAACTACCA

TCAAAAATCCACTTTCCACCA

279

5

0.16

ICCM0125a

FI856579

(AAAT)4

CGATCTGAGGATCAACTTGTGA

ACTAACCACCGTCGACCATC

253

NA

 

ICCM0125b

FI856579

(TTA)5

TATTTATGGTCTGGTCCGGC

CGCTACCAAATATGGAACGACT

251

5

0.19

ICCM0127

FI856581

(TAA)27

TGTTGAACGAATTTACTCATCG

GGTGGGCTCCTATTGTTTGA

269

6

0.40

ICCM0128a

FI856731

(TA)4N(TAT)4

AACCCTAATTTATTTGCACTATTATCA

TCAAAATACGGTAGTAGGATAAGATGA

161

NA

 

ICCM0128b

FI856730

(A)10

ATTTGGACGATGTGTCGCTT

TTATAGCCCCTGCTTTGCTG

266

1

0.00

ICCM0130a

FI856734

(AAT)22

GGATTTCGACTTTTATCCCTTTTT

CGGACTGGAATCAAAAGCTC

268

3

0.10

ICCM0130b

FI856734

(ATT)5

GAGCTTTTGATTCCAGTCCG

TGTAGGGGTGCATGGTGTAA

122

1

0.00

ICCM0131

FI856582

(AT)4N(TTA)8

AGAGCCAAACAAGAACCGAA

GTAAAGAGGGGCAGCTGTTG

192

NA

 

ICCM0134

FI856748

(A)11

TTTTGGAGGCAGCTTTGAGT

TGAAGACAGAGACGGTGCAT

109

3

0.08

ICCM0138a

FI856753

(AG)4

ATAAATAGCCGGCCACAAGA

CCGATTGTTTCAAGACCAGA

119

1

0.00

ICCM0138b

FI856752

(ATA)11

CTGTTGCCGATTTTATATTATTTTT

AAATGTGTTGTTCTGGCCGT

168

NA

 

ICCM0139

FI856755

(ATTC)4

TCACGATTTGAATGGTCGTG

CGTTTTCCCAGCTTCAACAT

151

NA

 

ICCM0141

FI856757

(AAT)20

AAGGTATGATGCAGTTCCCG

GGGCGGAGGGTAATTATTGT

247

NA

 

ICCM0142a

FI856759

(AC)4

GCATTGCCAATATCGAAGGT

AGTAGGTGCCAAATGCATCC

206

1

0.00

ICCM0142b

FI856759

(ATT)6

GGATGCATTTGGCACCTACT

GAGGTTGGTGTAGAATAGAATGGA

137

NA

 

ICCM0142c

FI856758

(AC)7

GGAGGTCCCGAGTCTAAACC

TCTTCAAGTCTGCTTGACGTGT

105

1

0.00

ICCM0143

FI856761

(AC)5

CTGCGGTCGATCTAGAGGAT

AAGGTTGAAGGATGATTGCG

257

NA

 

ICCM0150a

FI856583

(ATTC)4

TGATTGAAATGGTCGTGTCC

AGTCGTTTTCTCGGCTTCAA

279

1

0.00

ICCM0150b

FI856583

(TAA)8N(AT)4

GTAAAGAGGGGCAGCTGTTG

AGAGGCAAACAAGAACCGAA

192

5

0.16

ICCM0152

FI856792

(T)13c(CTT)4N(AG)5

CGTCTCACGAAGGAGAAGTG

AAAAATTCACTTGCTAATATTTCACA

197

1

0.00

ICCM0154

FI856794

(A)11

AGCTTGTTCGACAGCAGGAT

TCGATGTGAATATGCCCTCTT

247

1

0.00

ICCM0155

FI856796

(A)11

GACGGCAGGATTAACTGCAT

TTCGATGTGAATATGCCCTCT

240

2

0.04

ICCM0156a

FI856797

(AT)7N(CA)4

TGCATTCCCCTTTAATTTGG

CAGTGGTGGGGAGACAAAAC

280

2

0.04

ICCM0156b

FI856797

(ATA)52N(AAT)6

GTTTCTCCGTCCGCACTTAT

AAACAGTGTAAATTGTTGTTGGAAA

276

2

0.08

ICCM0157

FI856584

(GA)8

TTTGTTTTGAGGCAACCACA

AAACAAACCCAGTGGGAGGT

258

1

0.00

ICCM0158

FI856585

(ATA)18N(TCT)16

CCAAAACTGACAAGTCCCGT

GGGAAAATATGAGGAAGTTTGC

275

1

0.00

ICCM0159

FI856814

(T)17N(T)10

TGAAAAATCGGAAACCCTACC

CCTTGTTTTCAGGCGATTGT

247

6

0.46

ICCM0160

FI856816

(AAC)4N(TAA)25

TTGCTTGAAACAACCTTTCG

CGGGTACAACCGTAGCAAAT

263

21

0.93

ICCM0161a

FI856818

(AT)4

GATGGTCATCGGTTCGATTC

AACGAGGCCCTCTGTAACG

267

4

0.12

ICCM0161b

FI856817

(TAA)4N(AAT)4

ACTGTCAGGAAGGAACGGTG

TCCGTAACAAAAATTGTGAAGAAA

279

3

0.14

ICCM0162a

FI856586

(ATT)12

TAGCGCAGTCGATCTGAGGA

ACGTATCCCCAGGTGCAATA

272

NA

 

ICCM0162b

FI856586

(AAAT)4

GCAAGGTCTTTCCCTTGTCA

CGCCGCCAATTTTATTTTTA

278

1

0.00

ICCM0162c

FI856586

(T)11N(TA)4

TAAAAATAAAATTGGCGGCG

TCGTGTTAGGGTGTTTAGGGA

267

3

0.21

ICCM0162d

FI856586

(T)10

GACTCTGCTGGGGACAATTT

CGGGTTTAGAGACCCACTCA

225

1

0.00

ICCM0163

FI856820

(TC)4

CAACGAATTTCATGCTGTGG

TAGGGATGGAGAGGAGAGCA

274

1

0.00

ICCM0165

FI856821

(T)11

CGGACGTACACCTTTCGTTC

TGCTTCCGAATAACATAAAGCA

128

NA

 

ICCM0166a

FI856824

(T)11

GCCTACTCGCGGATTTTTATC

CCAGGTGCAATAGGGAAATC

276

3

0.09

ICCM0166b

FI856824

(AAAT)7

TGGGGATACGTAGGAGCAAG

TTGGATTCGGGAGTCGATTA

233

NA

 

ICCM0166c

FI856824

(AT)5

GCCTACTCGCGGATTTTTATC

CCAGGTGCAATAGGGAAATC

276

2

0.04

ICCM0166d

FI856823

(AT)4

GACTCCCCTACCACCTCACA

CGGACGCGACAAAAACTAC

275

1

0.00

ICCM0166e

FI856823

(TAT)48

AATAAAAATGCGGAAGTGGG

TGTGAGGTGGTAGGGGAGTC

276

1

0.00

ICCM0167

FI856588

(ATA)48

GAGTGTACGGGGATTATATGATGA

TCAAGAAAAGGAACCAAGGC

235

NA

 

ICCM0169

FI856589

(TTA)30

AGAGGCAAACAAGAACCGAA

GTAAAGAGGGGCAGCTGTTG

251

NA

 

ICCM0170a

FI856839

(TA)4

GCTTTGTTGCTTTCGTTCTTTT

AAAGTGTTTGGGGTGAGTGG

226

NA

 

ICCM0170b

FI856839

(C)10

CTCGCATTCCTTTTCCACTC

GGGGGAAAGTATGGGATGAG

154

NA

 

ICCM0171

FI856590

(ATTC)4

GACCGGGATCGTGTCATAAA

CGTTTTCCCAGCTTCAACAT

166

1

0.00

ICCM0172

FI856841

(AT)4N(AT)4

GCAGTCGATCTGAGGATCAAG

TTCACAAGATGTTTTCAGAACAAAG

278

NA

 

ICCM0174

FI856591

(A)11

CAGCGACCTCCTACTGGGTA

CAAAAATGGAGGATTTTTCCTT

175

NA

 

ICCM0176

FI856847

(TA)4

ATAGGCTAGACCGTCCGACA

TCTGAAATATGATGCAGCCG

273

5

0.16

ICCM0177a

FI856849

(AAT)28c(ATA)27c(TAA)4

CTTGAGTTCAAGCCAGAGAGG

GCGTTATTACTGTTACAAATGGCA

279

1

0.00

ICCM0177b

FI856848

(TAT)6N(TAT)11N(TAT)4N(TTA)6N(TAT)8

CCCTTCTTCCATTTCCGAAT

GGGGAGGAGAACGAAAAAGA

273

NA

 

ICCM0178

FI856592

(AAT)13

AGTTTGGGTTTCACCGCCT

GAACGCGCTCTGTTCATAAT

280

11

0.83

ICCM0179

FI856850

(TAT)4

AAAGGCCAGTTTACCCGACT

ATTTGATGCAGCAAGCAGTG

214

NA

 

ICCM0180

FI856852

(TAT)4

AGTCCCTGATCTCCCGAAGT

ATTTGATGCAGCAAGCAGTG

179

1

0.00

ICCM0181

FI856593

(ATA)5

CGGGTGTGGATAGCAAGTTT

TCTCTCCTTCCTAATAAAACAAACA

103

1

0.00

ICCM0183

FI856595

(TAT)15

TGAGGACTAAGATAATAGCAATCCAA

TTTTTACATGATTGTCTTTTTGTTG

168

1

0.00

ICCM0185

FI856597

(T)11

AAAGTTTGGCCTGGTCTGG

CATTCCATATTCAGTAGCATTCCA

250

6

0.46

ICCM0187

FI856599

(TAT)6

TGACCATCAATCCATTTCTTTTC

TGTTGACGTCTAATTTTGTCCG

280

NA

 

ICCM0189

FI856601

(TAT)62

TCCAGTTCCAAATGGCATAA

CCCTTGAGTTCAAGCCAGAG

273

3

0.21

ICCM0190a

FI856602

(ATA)6N(ATA)9

GGGGGATTGTCTGAGTTTCA

AAAAGGCTGGAGACACCTCA

195

7

0.53

ICCM0190b

FI856602

(TAT)5

TTTATTGCAGGAAGCGGTTT

CACCACTATCAAATGCCCCT

273

1

0.00

ICCM0191

FI856603

(T)10

CCTTACGCATAATCGACTCCA

AATTCAATTGAGTCGCCACC

130

5

0.37

ICCM0192a

FI856879

(TAT)15c(ATT)15

GCTGCCCAAATTTTGACATTA

CCGGGGATCAAATTCTTCTT

279

11

0.88

ICCM0192b

FI856878

(TAA)15tg(ATA)15

CGGACGGGGATAATTCTTCT

GCTGCCCAAATTTTGACATTA

279

15

0.76

ICCM0193a

FI856881

(TAA)5N(T)10

TGAACTTTCAAAACCAAACCAA

TTGTGACAATTTGAGGGTTCT

268

NA

 

ICCM0193b

FI856881

(AAT)7

TCGATTATAGCTTTATCTTTACCCTTT

AAAAGTGTTGGGAGGGGTTC

242

1

0.00

ICCM0194

FI856883

(A)10N(T)13

CGATTGTCCTAGTTTTAAAAAGAAA

CGACTTCCTGAAGGAACGAA

200

4

0.22

ICCM0196

FI856605

(ATA)5N(AG)6

GTCGGGTGTGGATAGCAAGT

AACACAATTCCTCAAATAACAAACT

154

6

0.47

ICCM0197a

FI856885

(T)13

CGCGTCTAGCAAAACAAGAA

TTCTCGGCCTATAAACATCAA

280

3

0.08

ICCM0197b

FI856884

(TATT)7

GATTCCGGAGTCCATTACCA

CTATTGCACCTGGGGATACG

241

NA

 

ICCM0198

FI856886

(A)15

CCATCCGAGAAAACTCGAAA

CAACGGTATCCATCGGAATC

163

1

0.00

ICCM0199a

FI856889

(A)10 g(AGAA)4

ACCAAGCAGACCACAACAAT

GTTTTCCCGGCTTCAACAT

265

1

0.00

ICCM0199b

FI856889

(CATT)5

ACCAAGCAGACCACAACAAT

GTTTTCCCGGCTTCAACAT

265

1

0.00

ICCM0199c

FI856888

(TTA)15

TTAGAGGCAAACCAGAACCG

ATCTTGAAGTGGGCAAAACG

241

15

0.86

ICCM0200

FI856890

(TAA)4

ACGGAGTGACCAGGAAACAC

GCAGACCTACAGAAACAGAGGAA

231

2

0.04

ICCM0201

FI856892

(TAT)7(TTATTG)6a(GTTATT)4

ATAGAGAGACCCAAACCGCC

GCCAAAGGCAAAAGAGATTG

135

NA

 

ICCM0202a

FI856894

(T)10N(T)10

CGCCGATCCATTATACTGAC

TTGCCTCTGATTCTGGTTCA

192

2

0.04

ICCM0202b

FI856894

(TTA)13

TGAACCAGAATCAGAGGCAA

CCAATTTGGTCCGGTTTTTA

207

12

0.77

ICCM0203

FI856606

(CT)6

TGGACGTAGGTTGTTGTGGA

TTGGTATCAGTGACCTCGCA

194

1

0.00

ICCM0204

FI856607

(TC)7

CACATACACTCCCCAATCCC

TGCAGACTGTTTGGTTCGAG

258

1

0.00

ICCM0205

FI856608

(TA)9

CGACCATGATTCTCTGATGTG

CACCTCTGCATTTCTTCAAACA

263

8

0.26

ICCM0207

FI856610

(TA)4

TCAACCATAAAGCACTCCCC

GGCCATTTGTGTTTTGTATGG

182

2

0.04

ICCM0210

FI856898

(TA)4N(TG)4N(CCA)4N(AG)16

GACCATTGCCCACTTCAACT

AGTTCTGCGAGAGGAATGGA

253

NA

 

ICCM0212a

FI856902

(T)10N(AT)4N(TA)5N(TA)4

TCCTATACCGAAAACCCCATT

CAAAATGGATGGATTGTGGG

270

2

0.04

ICCM0212b

FI856901

(GA)4

ATTGCCGTTGAGAGAAGTCG

TCGGTCACCACACTACCAAA

183

1

0.00

ICCM0212c

FI856901

(AG)8

TTTGGTAGTGTGGTGACCGA

AACCCAAAAACGTGGACTCA

161

6

0.32

ICCM0214a

FI856612

(CT)6N(AC)4

CTCTTCAATAGCCCCATCCA

CGTTGGAGAGGCTGAAACAT

249

1

0.00

ICCM0214b

FI856612

(TTTA)5

ATGTTTCAGCCTCTCCAACG

TCGCACCTGAACTCTCTGTG

276

NA

 

ICCM0215a

FI856613

(TC)5

CCTTCAGTGTTTGGCTCACA

CTCCAGGAATCCACAGCATT

253

3

0.15

ICCM0215b

FI856613

(T)11

AGAATGCTGTGGATTCCTGG

GCAAGCCCAAAACTTCAAGA

276

1

0.00

ICCM0216a

FI856614

(TG)4

CGGGACTTTCATCTGCTGTT

GTGGGACATCCTCCAAGAAA

200

2

0.04

ICCM0216b

FI856614

(AG)5

AAAGCTGGTGGTCGAGCTAA

GACCACCGAACCAGGATAAA

277

3

0.09

ICCM0219a

FI856906

(ACC)4

CCTTTTAAGGGCTGAAGGCT

TGAAAGAATGTGGGGGAGAG

203

NA

 

ICCM0219b

FI856906

(CT)5

TCATCCTACCCAATTGCTCC

GTAGTGGGGTAGGGGATGGT

240

3

0.10

ICCM0219c

FI856905

(CT)4

CTCACCCACCACACCTATCC

GCGAAGGGAGAGAAGGAAGT

278

NA

 

ICCM0219d

FI856905

(TC)5

CTCACCCACCACACCTATCC

GCGAAGGGAGAGAAGGAAGT

278

NA

 

ICCM0220

FI856908

(TA)4N(CT)4

TCAACCATAAAGCACTCCCC

GGCCATTTGTGTTTTGTATGG

183

1

0.00

ICCM0222

FI856617

(CT)5

TCCGATTGGATTTTCAGGAC

GGTATCAGTGACCTCGCCAT

210

1

0.00

ICCM0223a

FI856912

(TCT)4

TACAACTTTTGACACCGCGA

AGTGGCAGTATGCGTTGAGA

224

NA

 

ICCM0223b

FI856911

(TC)4

GCTCTGTCGGTCTTCCTGTC

ACAAAGCGCTCGAATAAGGA

208

NA

 

ICCM0224

FI856914

(CT)4

ACCACCTTGCTCATCCTCAC

GAGTAGGAGGTGCGAAAACG

274

16

0.74

ICCM0225

FI856915

(CT)4

ACGTCCGGATTTGTTCTCAC

ATTATAGGAAGATGGCGGGG

252

6

0.27

ICCM0226a

FI856537

(A)12

CCAACGACGCGGATAAATA

AATGCCCACCCATAATTTCA

273

1

0.00

ICCM0226b

FI856537

(TA)4

GAAAAAGCGCTGTAAATGGC

CCTCGCATTTTGTTCTCAAAG

145

1

0.00

ICCM0228

FI856619

(CT)6

TGGACGTAGGTTGTTGTGGA

GGACCGGGAGTCCCTTATTA

274

1

0.00

ICCM0229

FI856916

(C)10

TGTCTTATTCCTCCTCCCCC

AGGGGTTTTTGGGTTACCAG

158

9

0.69

ICCM0231a

FI856919

(TTA)21N(TC)4

CTGGGGATACGTAGGAGCAA

GGAGTGAGATAAGAAAGAGAGGAGG

278

NA

 

ICCM0231b

FI856919

(TC)4

ATCCCACCTTACCACCCTTC

GGAATGAGGAGGGATTGAGA

279

2

0.05

ICCM0232

FI856920

(T)10

ACGGGAAGTTTCTGGGTCTT

TAGCGGAGAAACAGGACTGG

253

3

0.09

ICCM0233a

FI856922

(TA)4N(TTA)4t(TTA)4

CTCACCACTAGGGATGGGAA

AGACTCCCGAGGGATTGACT

242

NA

 

ICCM0233b

FI856922

(A)10

AGTCAATCCCTCGGGAGTCT

TGTTGAGGGCCTTAGATTGG

256

NA

 

ICCM0234a

FI856925

(TTA)4

GGGACTACTTTCGCGATTCA

GTGGGTAATCCGTGCGTAAT

229

1

0.00

ICCM0234b

FI856924

(TA)4

CAGGCTATGTCATCTCGTCG

CCTGACTGCCACAAGTTTCA

270

1

0.00

ICCM0234c

FI856924

(TCG)4

TGCTTCCGTACAGGCTATGTC

CCTGACTGCCACAAGTTTCA

280

1

0.00

ICCM0235a

FI856927

(TC)4

TCGCTCATGACAGACTCGAC

GTAGCAGGTGAGATGCACGA

173

5

0.32

ICCM0235b

FI856926

(GT)4c(GT)4

GCCGACCCGATTACCTTACT

GAGAGCTAAGGGGAAGGTGG

176

NA

 

ICCM0236a

FI856621

(CGC)7

GCTTGTTGCCCTGTATTGGT

AAAACGCAAGCAAAGCAAGT

151

NA

 

ICCM0236b

FI856621

(ATT)4N(A)10

ACTTGCTTTGCTTGCGTTTT

TTTGTGGGTTGGTTGATTTT

219

2

0.04

ICCM0236c

FI856621

(A)10N(TA)4

AAAATCAACCAACCCACAAA

ATCACTCTACCGTCAAAACGA

244

2

0.04

ICCM0237a

FI856622

(AT)4N(ATT)6

TCAACCATCCCTAAAAACATTTG

TTCCTTTGCCATTTATGTTTTG

184

6

0.34

ICCM0237b

FI856622

(A)13

CAAAACATAAATGGCAAAGGAA

TCGTGTTGTATTGTGCCGAT

155

2

0.04

ICCM0237c

FI856622

(AG)4N(GA)4

TGTGTTTCTCGATGGCAGAG

CTTTTTCTCCCTTTCCACCA

120

1

0.00

ICCM0238

FI856623

(TC)4N(TC)4

ACCATAGACGAACCACCACC

CCAAGGGGGTACAACTTGTGT

215

1

0.00

ICCM0240a

FI856650

(TA)12

ACCCGAACCCGCAAATAATA

GCAATGAGACTGGGGTTTTC

248

NA

 

ICCM0240b

FI856650

(TA)4

ACCCGAACCCGCAAATAATA

GCAATGAGACTGGGGTTTTC

248

19

0.77

ICCM0242a

FI856929

(AAT)18

TGCATTCATCTGTTTCGCTC

GAAAATATTTGTGGTTATCCGATTTT

263

8

0.74

ICCM0242b

FI856928

(A)11

ATCCGCAACACAACAAAACA

CCCTACTCGTAATCGACTCTCG

252

4

0.21

ICCM0242c

FI856928

(TAT)5

CAAGTGCAATAGGGAAATCCA

ATAGGGCTTTCCACCGATTT

210

NA

 

ICCM0243a

FI856931

(AT)5N(AT)4N(AT)8

TCAGGAACAGACGGAACTTTTT

GGGTTCAAATCCTATTGGGC

277

3

0.08

ICCM0243b

FI856931

(AT)4

ATTTGCGCCCAATAGGATTT

TTTTTCTATCGGAATATCTCATTTTCT

280

1

0.00

ICCM0243c

FI856930

(GA)41N(AG)10

ACGACGATTCTGGATTTTGG

AGTTTTGGTAGGGGGTCGAG

237

16

0.88

ICCM0244a

FI856933

(AT)8N(TTA)4(TAA)4N(TTA)6N(ATT)4

ATGCGGTAATCCTTGACTGG

TGCAGGGAGTGAATGTGTGT

252

5

0.25

ICCM0244b

FI856933

(TA)5

CACACATTCACTCCCTGCAA

GATGGAAGGGAGGGGTAAAA

268

NA

 

ICCM0245

FI856935

(AG)5

GCGGCTGGTTTAAGAGTGAG

CCAACACGACCCAAATCAAT

182

6

0.53

ICCM0246a

FI856937

(AT)4

TCTGACAGCTCTTGCCTTGA

AACACCCAGACCCCTTTCAT

280

4

0.12

ICCM0246b

FI856937

(TA)4

TGAAGAGGAAGAGACGGGAG

AATCCATTTACGGGGGTAGC

268

NA

 

ICCM0246c

FI856937

(TATTT)4

TGAAGAGGAAGAGACGGGAG

AATCCATTTACGGGGGTAGC

268

1

0.00

ICCM0246d

FI856936

(TC)4

GATCACGGTTACGAATGCAA

TAAGGTTCCCATTGGCTCTG

209

1

0.00

ICCM0247

FI856626

(TTA)8

CCTCAATTCATTTTTCTTCGG

TTTCCCGATAAACCATCTGTT

136

2

0.06

ICCM0249

FI856627

(T)12N(TAA)29

TTTCTTCGCATGGGCTTAAC

GGAGATTTGTTGGGTAGGCTC

193

5

0.16

ICCM0250

FI856940

(TAT)40

TTTCAAACACAATCTGAACGAGA

CCACCTTCGGGTAGGATACA

231

2

0.04

ICCM0251a

FI856943

(AC)4

TCCCTGCTATACACCCATCC

TGGGCATATATGGATCACGA

252

1

0.00

ICCM0251b

FI856943

(CG)4

CTACACCCGCCAACCTCTAC

AAGTGTATGTGACCGAGCCC

261

1

0.00

ICCM0251c

FI856943

(CA)4

AACCCATAATACGCGCTCAC

GGGGTGGTAAGGTAGGAGGA

206

2

0.08

ICCM0252a

FI856945

(CCT)4

TCTACCTCTCCGCTCTTCCA

TGGTGATAGGTGGTGGTTGA

203

1

0.00

ICCM0252b

FI856944

(T)11

TTGACGGTGGGGGTATACAT

TCCACACACTCCCACTACCA

267

NA

 

ICCM0253

FI856946

(AT)5

TCCCTTACAAGCATTCCCTG

TGGGGACCGTTTTTCACTTA

110

NA

 

ICCM0254

FI856628

(TAA)4N(TAA)29

GCCAAGCCCATTAAAACACT

CGTTGTTAAAAACCGCGTTG

273

1

0.00

ICCM0255

FI856629

(ATA)8N(AAT)4N(AT)4

GGCTACCGAATATGGAATGC

TGGCCTGACCTACTTATGGC

272

2

0.04

ICCM0256a

FI856949

(AT)4

ACCGCTCATTTCCATACGTC

TGGATCAAGAGGGAGGATTG

195

NA

 

ICCM0256b

FI856948

(CT)4

TTTCTCTTTTGGTGGTTGCC

TTAAGGTTTGCCACTCCTGG

247

4

0.17

ICCM0256C

FI856948

(TTA)19

TTAAGCCAGACGTGGGAAAC

AGAAAGAAGGGAAATGGGGA

236

2

0.08

ICCM0257

FI856630

(ATA)44N(AAT)11

TCGCTTCCAACATTCAAAAA

CAATTGCACTTATAGCACAAACA

255

2

0.04

ICCM0258

FI856950

(ATA)11

TGCATAGGGAAATCAAAACACA

TTATTTCACCGTCGTGTCCA

271

1

0.00

ICCM0259

FI856631

(TTA)15

AGAGGCAAACAAGAACCGAA

CGAAGCCGAGAAAATGACTC

261

2

0.04

ICCM0261

FI856633

(TAA)23

GTCCGGGGATTCAGTAGGAT

CAAGCCACGGAACTTGTTTT

232

NA

 

ICCM0263a

FI856635

(TATT)7

CGGGGATAAATCAACACACC

GGGCAAGGTCTTACCCTTGT

265

2

0.08

ICCM0263b

FI856635

(ATA)19

GGTAGAAAATATTTATGTGTTGACCG

CTCGTTCACATACCGCCATA

260

1

0.00

ICCM0265a

FI856636

(AT)5

GGAACTCGGGATTGAAATAGTC

TTGCAAAGAAAACAATTTTAGGA

214

NA

 

ICCM0265b

FI856636

(A)13

CGTTTAATCCTAAAATTGTTTTCTTTG

ACGGCGACAACCATTAATTC

190

1

0.00

ICCM0265c

FI856636

(TAT)9a(ATT)10N(ATT)11N(AAT)4

TACCGCCACGTTACGTTTTT

GAAAATATTTGTGTGTTGACCGA

248

4

0.14

ICCM0266

FI856955

(TAT)31

GAATCGTGAGGGGGAGATTT

GGGGGAATCAAAAGGCATAG

269

NA

 

ICCM0267a

FI856637

(TATT)4

CAACGTCCGTTAAAACGGTTA

TGGGGATACGTAGGAGCAAG

179

1

0.00

ICCM0267b

FI856637

(TTA)4N(TAA)8N(ATA)12

CTTGCTCCTACGTATCCCCA

AGTCTCGTTCACATACCGCC

272

1

0.00

ICCM0268

FI856957

(CT)7N(TC)4

TTCATCTCTGCCCAAACTCC

TGGGTAGATGGAAGGAGTGG

220

1

0.00

ICCM0269a

FI856959

(AC)4

CCCTCTTTACACCCCACCTT

GTAGTGGAGTGGGGCAGGTA

129

2

0.04

ICCM0269b

FI856959

(TC)5

AACATCACTAACCCTCCCCC

AGGTGTGGGTGGTAGGAGTG

209

NA

 

ICCM0270

FI856638

(TAT)16

TCACATACCGCCACAATACG

ACGTATCCCCAGGTGCAATA

276

1

0.00

ICCM0271

FI856639

(GT)4

ACCCGGGTATAAGGTTCCAC

TGCTTGTTTTTCATTTTCATTTTC

240

3

0.11

ICCM0272a

FI856961

(A)12

TTTCCACTTGGAACAGGCTC

AATGGACGATGGTTGGGTTA

280

3

0.12

ICCM0272b

FI856960

(GA)10N(AG)20

CGCGGTTGAGTTAGAGTGGT

CAAATCGGGGATTTTGTTTG

175

12

0.74

ICCM0272c

FI856960

(GA)4

CGCGATTATTACCCACGTTT

GGAAAGGAGGTACCGGAGTC

249

3

0.09

ICCM0273

FI856963

(TGA)4

TGTAACTCATCATCGCCAGC

AGACGTGTAGACAGATGCCC

108

2

0.04

ICCM0274

FI856640

(TC)9(TA)15

GACCCTACCCCGCAAGTAAT

TTTTTGTCCACACTCACACCT

265

NA

 

ICCM0276

FI856965

(C)10

CTCCTACACTGCCTCCCCTC

TCATGCTTACTCCGTTGCAG

222

NA

 

ICCM0277

FI856642

(TTA)11

GGCAAACAATAACCGAAAACA

GTAAAGAGGGCCAGCTGTTG

196

6

0.30

ICCM0278a

FI856643

(TTA)4

ATAGGGGACCAAAACTGCAA

GTGGGTAATCCGTGCGTAAT

203

1

0.00

ICCM0278b

FI856643

(AT)4

AAAATACACATCCTGACTGCCA

TTTTGCTTAGACTTGTAGGCATT

159

2

0.17

ICCM0280

FI856969

(T)11

ACTAGATGGTCGCATCCTGG

GGTGAAGGTGTGGATGAGGT

280

1

0.00

ICCM0281a

FI856644

(AC)9

TTCAACCCTCCCTACACGTT

GTTCTCTTCTTGCTGGTGCC

235

1

0.00

ICCM0281b

FI856644

(AAT)5N(A)11

TGGAACAACCAAGACCTTCA

GCTGCCACAAACACTGAGAA

264

2

0.04

ICCM0282a

FI856645

(CGC)7

CCTCGTTGTTGCCCTGTATT

AAAACGCAAGCAAAGCAAGT

154

3

0.23

ICCM0282b

FI856645

(ATT)4N(A)10

ACTTGCTTTGCTTGCGTTTT

TTTGTGGGTTGGTTGAATTTT

219

NA

 

ICCM0282c

FI856645

(A)10N(TA)4

AAAATTCAACCAACCCACAAA

ATCACTCTACCGTCAAAACGA

250

4

0.25

ICCM0284a

FI856647

(AT)4

CGTATCTACACCCGCACTCA

TGGAAAATCCACTTTGATTGG

257

3

0.08

ICCM0284b

FI856647

(TA)4

CGTATCTACACCCGCACTCA

TGGAAAATCCACTTTGATTGG

257

9

0.30

ICCM0285

FI856971

(ATTC)5

TGAGGACAAGATTCCGTTCA

AACATGCGGGTTGTTTTCTC

267

1

0.00

ICCM0286a

FI856648

(GA)5

AGCATCACGCATACAGCTTG

ACATTGGCTCCATTGTTTGG

254

2

0.04

ICCM0286b

FI856648

(AG)4

ACCCCCAAAATGCTGTAGTG

ACGCCCCTTTACTGTTACGA

276

1

0.00

ICCM0288

FI856972

(TAA)4N(TTA)4N(TTA)4

TTATTTTTCGGATCCAACGC

GTGATTTTTGTTCGGCCATT

278

20

0.88

ICCM0289

FI856976

(T)13N(ACA)4

CAGCCTCCATGGCATAGATAA

TGCTTGAATGAGTGCAACAA

219

15

0.83

ICCM0290

FI856976

(A)15

TTGTTGCACTCATTCAAGCA

TTTTTATTGGGGCATTGAGC

244

6

0.38

ICCM0291

FI856978

(AT)4

AAGTATTCAATTATACGTGCACAAAA

TCATCCTTGTTAAGTCAACCACTT

249

1

0.00

ICCM0292

FI856978

(TAA)6

TGGTTGACTTAACAAGGATGAGTG

TCCTCAAGCAGAGGTGGTTC

267

1

0.00

ICCM0293

FI856982

(TAA)15tg(ATA)15

AGTGATGCCACGAGAATTGC

CTGGTTCGGAATTGTCATCC

250

5

0.24

ICCM0294

FI856986

(TTA)15

AGAGGCAAACAAGAACCGAA

CACCCAATTTTGTCCGATTT

185

NA

 

ICCM0295

FI856987

(T)10

GAGGCACCAAATTCGTATCC

CAAAATTTTCTAATTCACCAAGACTTC

256

3

0.09

ICCM0296

FI856987

(TGATT)4

CGCCAAGTTTTACTATGTGCTG

TGTCTGGATGTTACATAAACACTCTT

227

1

0.00

ICCM0297

FI856987

(TAA)18

CATGATTTGATTTGATTTGATTTC

GGAGTGGGAAACCTTAAGCC

271

3

0.08

ICCM0298

FI856989

(TC)4N(AAT)4

GTGCACTTGTTCAGCGTTGT

CGCAAACACACATTCCTCTG

221

5

0.33

ICCM0299

FI856989

(CTT)7N(TCT)4

TTATGAAGCCGAAGCTCGTT

GAGCAGTAAACGTACCCCCA

272

NA

 

ICCM0300

FI856990

(A)10

ATGGCCAAAATGAACTCCAG

AAAAGAGAAGGTTCCATCGG

173

2

0.10

ICCM0301

FI856992

(A)10

ATGGCCAAAATGAACTCCAG

AAAAGAGAAGGTTCCATCGG

173

1

0.00

Marker names start with prefix ICCM, which represent ICRISAT Chickpea Microsatellites

NA not amplified

aSSR motifs having “N” nucleotide represent the interruption of few base pairs between two same/different SSR motifs

bNumber of alleles is calculated based on screening 48 chickpea genotypes using touch-down PCR profile of 61–51°C

Development of gene-based SNP markers

PCR primers derived from Medicago ESTs (expressed sequence tags), Medicago BAC (bacterial artificial chromosome)-end sequences, and M. sativa cDNA sequences have been described in previous studies (Choi et al. 2004a, b, 2006). To design PCR primers based on chickpea ESTs (Buhariwalla et al. 2005), candidate chickpea transcripts were compared to sequenced Medicago BAC clones (http://www.medicago.org/genome), and transcripts with high nucleotide identity and low copy representation to the Medicago genome were selected for primer designing. Primers were designed from highly conserved coding sequences, to amplify across intron regions (Choi et al. 2004a), using the Lasergene PrimerSelect software package (DNAStar Inc., Madison, WI, USA). Details of these primer pairs are given in Table 3.
Table 3

List of gene-based SNP anchor markers used in comparative mapping of chickpea and Medicago

Marker name

Template sequence accession no.

Type

Sequenced Mt BAC accession no.

Linkage group in M. truncatula

Linkage group in chickpea

Genotyping method

Restriction enzyme

Forward primer (5′–3′)

Reverse primer (5′–3′)

CALTL

AW126242

Mt/EST

AC149080

1

4

CAPS

Alu I

GTGGAAGGCACCATTGATTGACAAC

TCTTCTTCTCAGCCTCTTCAAATGC

CDC2

AW171750

Mt/EST

AC144481

1

4

SNaPshot

N/A

CAACTTTGCAAGGGTGTTGCTTTCT

ACTAACACCTGGCCACACATCTTCA

CysPr2

AI974635

Mt/EST

AC148098

1

4

CAPS

Taq I

CCAAAAACTTGCTTCTATACTCTTCATTC

GACAAAACCCACCCAGACAAATCAACTAG

HRIP

AW126332

Mt/EST

NA

1

4

SNaPshot

N/A

GGAAAAATTTATCCTCCAAATTGGGGGTA

AAAAATAGCAGTGCACCAAAAAGTGCTG

ppPF

AI974685

Mt/EST

NA

1

4

SNaPshot

N/A

TCTCGCCACCAACAACAACTAC

AAAAATTGTTCATGAACACTCACTTGAAGCCA

REP

AA660953

Mt/EST

AC133709

1

4

CAPS

Taq I

CTCCATTTCCCGTTCGTTCG

CACCGGTTGCCCTCCAGAC

RL3

AI974458

Mt/EST

AC125473

1

4

CAPS

Hind III

TTCAATCGATAAGAATACTGCTTTG

TGTGTGTCATACCAGCCTTG

TC76700

TC76700

Mt/EST

AC122171

1

4

CAPS

Hinc II

CCAAAGACCCAGTTCGTGTT

GTTGCATGGTTGACATCAGG

TC86606

TC86606

Mt/EST

AC139748

1

4

SNaPshot

N/A

TGAAAATGGCAATGTGGAGA

TTGGGATTCCTCATCCTCAG

TC87270

TC87270

Mt/EST

AC124216

1

4

CAPS

Dde I

TGGCTTCTTTCGGTCTCTGT

TCAAAACCACGCATTTGGTA

TC88727

TC88727

Mt/EST

AC137895

1

6

SNaPshot

N/A

ATCAGGCAGAACTTGCTCGT

AGAGTGCCCGGTATATTCCT

DSI

AA660976

Mt/EST

AC122168

1

4

SNaPshot

N/A

GAAGCCAAAAAGTATGAAGGGCCACGCAC

CATGGTGCATAAAACTCAACCAAGACATC

ChitinaseII

NA

NA

~AC137554

2

1

Pfaff and Kahl (2003)

AGCACATGAACCAATCCACA

CATGGTTGCAATTTCACGTC

ACCO

AI974230

Mt/EST

AC121236

2

1

CAPS

Stu I

GAAGATGGCGCAAAAAGAAAGT

CGATGTGTCGTGTCATCTCGTTAAGTTCCCT

AJ005043

AJ005043

Ca/EST

~AC127170

2

1

SNaPshot

N/A

TTTTCGGGAACTGCTTATGG

CATGGAAGTGGACCGTTTTT

CPCB2

AW191283

Mt/EST

NA

2

1

CAPS

Dra I

AGAAAGAGTGAAGTCTGTGGATCTACATC

GGATGAACAGCCACACACCTAATGTAATC

DMI-1

AY497771

Gene

AC140550

2

1

CAPS

Hinc II

ACCCTTCTTTCCTTGGCATT

ACCGCATACAACGCTAAACC

TC77488

TC77488

Mt/EST

AC126013

2

1

CAPS

Afl III

ATGCTTGCAGATCCTGCTTT

GATCTGCCTCAACTCCAAGC

1433P

AI974411

Mt/EST

AC144342

3

5

SNaPshot

N/A

AAGGTTTTCTACCTTAAGATGAAGGGAG

GTTTAGCAAGATTGCAGGCACGA

AF457590

AF457590

Ca/EST

~AC122728

3

5

SNaPshot

N/A

CTCCCTCTCTATCGCCCTCT

TGTGAAAGGGTTGGTGTGAA

AIGP

AW125928

Mt/EST

NA

3

5

CAPS

BSPW I

CTGATAGGGCCAGGAGGCAGGGAAGA

GTTTTTTAGCATTTGGACGAATGGTTGGT

CysPr1

AI974595

Mt/EST

AC131026

3

5

CAPS

Ear I

GAGAATTCAAAGAAGAAATTAAGACAAAGA

GAAGAATTCATGGGGAGCAAAGT

Ms/U515

AJ410128

Ms/EST

NA

3

5

SNaPshot

N/A

GTTAAGGGAACCATGACAACCACA

CCAGGCTCGGATTGAGCAGGGTTTGT

Ms/U83

AJ410159

Ms/EST

NA

3

5

SNaPshot

N/A

TGGAAAACTTGATGGATCCTGCTCA

TGATAGTCCTGCAACAAGTCCAGCA

P40

AJ006759

Ca/cDNA

~AC143340

3

5

Pfaff and Kahl (2003)

TTTTTAAACGCCGCAATGA

CAGAAAGCAATGGTGGGAAT

TC80362

TC80362

Mt/EST

AC137828

3

5

CAPS

Ase I

GCTTGAGCCTCCAGAGATTG

TGATAAGCCTTGCAGTGTGC

TRPT

AA660362

Mt/EST

AC122170

3

5

SNapshot

N/A

CAACAACCTAGTATAGCGATCAGTG

CATTCAAAGCCCACCAAGTT

DNABP

AI737524

Mt/EST

AC121244

4

6

CAPS

Afl III

CCCTATGAGCTTGGGTTTGTCT

CTCATGGCATACGTGTTCAGC

EST948

AA661051

Mt/EST

AC145021

4

6

CAPS

Dde I

GCAGGGGTTTCGCTCCAGTG

AACTTAATGAATGATTGGAAGGTTTAGCG

Ms/U40

AJ410120

Ms/EST

NA

4

6

SNaPshot

N/A

AAGAATGAGGAAGAGGAATTCAACA

GGTTCCTAAGGAACAATGATGACA

MTU07

AI737610

Mt/EST

NA

4

6

CAPS

Bsm I

CAGACACCCAAAGAATTACCAGAA

GATGACCAGAGCCTAATACTATTTATGACT

TC78756

TC78756

Mt/EST

AC144502

4

6

CAPS

Alu I

GGAGGAGGAGGAAGATCAGG

ATGCTGGAGAGATGGTGAGC

TC79726

TC79726

Mt/EST

AC130805

4

6

CAPS

Cla I

TGCTGAAGGGAGGATTCAAG

ACAGCATTGTGAGCAACCAC

TC88598

TC88598

Mt/EST

AC135316

4

6

CAPS

Bcl I

AGATGGGGAGATTGATGCTG

AAGCAACATGCAGTGAGCTG

TGDH

AA660742

Mt/EST

NA

4

6

SNaPshot

N/A

CGGTGGCTTCATCGGTTCT

GACGTGTATTGTAATCAGCAGGAGTA

tRALS

AW126282

Mt/EST

AC125476

4

6

CAPS

Msp I

GGTCTGCGAGCTGTTTTTGGAGAAG

GCAATTCCCTCCTCAGCTAAAAGTG

U71

AJ410150

Ms/EST

NA

5

8

SNaPshot

N/A

GCTGAAGCTGAAGGTTTTCG

CGCATTTTTATGGATGAAGAGA

X60755

X60755

Ca/EST

~AC137669

5

8

SNaPshot

N/A

AGGTGCCATAGGAAGACACG

CCCAATCTTTTTCTCCCACA

AB025002

AB025002

Ca/EST

~AC122727

5

2

CAPS

EcoR V

TTCCTCGATCATGTCGAACTT

CGTGCACCAGCTTCGTAGTA

AJ005041

AJ005041

Ca/EST

~AC122727

5

2

CAPS

Dra I

AGCGTCTAGCCAGCATCAAT

CCATGGCTTCTTACCCTTCA

AJ404640

AJ404640

Ca/EST

~AC131455

5

2

CAPS

Pst I

TGGAGAGAATGAGGGGAATG

TCAAAGGATGCCAAATCACA

CYSK

AW207985

Mt/EST

AC135320

5

8

SNaPshot

N/A

GGAATTGCTAAAGATGTTACAGAATTGA

AATGAGGACACTCTGTCCAGGTGTGA

CYSS

AW127154

Mt/EST

AC135320

5

8

CAPS

Bgl II

CTGATGCAGAAGAGAAGGGGCTTATCA

CCAATTCAGCTCCAAAAGCTAATAGAATGA

DK242R

AQ917211

Mt/BES

NA

5

2

CAPS

BsmA I

CGTATGTTTAATCCGTTAGTCCGTCTT

GCTTGCTTAGATATTTGGCACTTCA

FENR

AW127593

Mt/EST

AC138010

5

8

CAPS

Hph I

ATGCTTATGCCAAAAGATCCAAATGC

CTCACAGCAAAGTCGAGCCTGAAGT

Ms/U393

AJ410119

Ms/EST

NA

5

2

SNaPshot

N/A

ATTGGAGAAGGGCAATCCTCCACCA

TCCCTTCATTCTATCCATCCCAAGA

Ms/U89

AJ410164

Ms/EST

NA

5

8

CAPS

EcoR V

CATATGAACAGTTGAAAGTGGATGA

CAATATGGCCAACATTAAAAAATGGCA

TCMO

AW127521

Mt/EST

AC141923

5

5

CAPS

Hph I

GTCTACGGCGAACATTGGCGTAAAATGC

CAATTGCAGCAACATTGATGTTCTCAACA

TC87369

TC87369

Mt/EST

AC124591

6

2

CAPS

Pvu I

ATAGTGGACTTCGGCGAGAA

TGACGGGGATCTTTTCTTTG

AGT

AW126002

Mt/EST

NA

7

3

CAPS

Xba I

GATTTGGGCCTCATTCCTTCTTGTGTGCA

CCTGAAGGGGGAAAATTGCCCACATTGA

AJ004917

AJ004917

Ca/EST

~AC136505

7

3

CAPS

Dde I

CCAAGGAAACCAGTGGATGT

GCAGCATCAAGATCACGAAA

AJ012739

AJ012739

Ca/EST

~AC130801

7

3

CAPS

Dra I

CTTCAGTCAGGAGGGAGACG

TGCAAATTTCGCTACAAGGA

AJ291816

AJ291816

Ca/EST

~AC140025

7

3

SNaPshot

N/A

TTGGAGGTGCTGGTGATGTA

TGCAAATGCTTGCCAAATAG

DK225L

AQ917191

Mt/EST

AC137994

7

3

CAPS

Hinc II

TGTCCTTGCTTCTTATCCTTCCTTCA

AGCAGCACAACAACTTACAACAACTC

ENOL

AA660534

Mt/EST

NA

7

3

CAPS

Dde I

TTCCATCAAGGCCCGTCAGA

TTGCACCAACCCCATTCATT

MS/U380

AJ410118

Ms/EST

NA

7

3

CAPS

Taq I

CACTCATTGCAATTTCCATGCTTCA

CAGTTGTTGTAGCAAGGGCACA

RNAH

AI974503

Mt/EST

AC123899

7

3

CAPS

Mbo II

GCTTCCACCAGCTGATACACG

TTAGCCCTAGCAAGAATGTCACTG

TC76881

TC76881

Mt/EST

AC136505

7

3

CAPS

Hph I

TTCTTGGGGAACAGAACAGG

GCAGCATCAAGATCACGAAA

TC78638

TC78638

Mt/EST

AC135795

7

3

CAPS

Acc I

TGATTGCAAAGCAGGTTGAG

CGGCATTCAGTAGGAAGCTC

TC84431

TC84431

Mt/EST

AC139355

7

3

CAPS

Nsi I

AGAAAGGACTTGGGCAACCT

CCAATACGTGCCTCTTTGGT

TC86212

TC86212

Mt/EST

AC124963

7

3

CAPS

Hinc II

GTGGCTCCTTGTGTGCTGTA

AGCCAGGATGAGGCACTCTA

TC88512

TC88512

Mt/EST

AC136974

7

3

SNaPshot

N/A

CTACTGTTGGACGGGTTGCT

AACCTGGGGCATTTGTGTAA

TC88726

TC88726

Mt/EST

AC121242

7

3

SNaPshot

N/A

GAGGAGAATACGCCATCCAA

GGATAGTGTGGGCTGCATCT

AJ276270

AJ276270

Ca/EST

~AC122726

8

7

SNaPshot

N/A

GCTGCGAATTTTGACCTAGC

TGCCTTTGCAGATTCAGTTG

AJ276275

AJ276275

Ca/EST

~AC140032

8

7

SNaPshot

N/A

TTTTTGCCTGGACCAAATTC

AAGGCTTGTACTGCCCTTGA

AJ489614

AJ489614

Ca/EST

~AC138087

8

7

SNaPshot

N/A

CGAGGAAGAATGGCAAAGAG

AACAAGCCAATGAGGGAGTG

CoA-O

AI974546

Mt/EST

AC119408

8

7

CAPS

Nla III

TTTGGGGGAAATAATGGAAGTCT

CTCGGGCAATGTTGAAAAATC

CPOX2

AW127442

Mt/EST

NA

8

7

SNaPshot

N/A

AAAGAATCATGTCCTCAAGCTG

CTTCTTCTTGTGGAAGTCAGCA

EST671

AA660779

Mt/EST

NA

8

7

CAPS

Hpa II

GGTGTTATCTATGAAAGAGGCCTCATTGG

TGTCCTTGGGTATGTAGAAAAGCCTTCAC

FIS-1

AI974522

Mt/EST

AC122726

8

7

SNaPshot

N/A

TCAGTGATTGAGGGTTTTTCTACG

CTGTTTCATCAACTTCAGCAACTTT

Ms/U82

AJ410158

Ms/EST

NA

8

7

SNaPshot

N/A

TTCGTCAACGAGATGTTTGTGTTGGC

CAAATTGAAGAAAAGAGGAATGAAGGT

AJ004960

AJ004960

Ca/EST

~AC136142

Unknown

2

CAPS

BstN I

GCCTGGTGTGATCGTTACCT

ATGAAACCGGCAAAGACTTG

Ms/L591

AJ410091

Ms/EST

~AC148970

Unknown

3

CAPS

Hind III

GGCAGCTATAAAATCAAGTATCATGC

TGCCACTTCGCCAAAGGACTCATTA

“~” denotes that the putative orthologs of the chickpea genes are located in the corresponding M. truncatula sequences (Genbank accession numbers). TC#’s are from TIGR gene index database (http://www.tigr.org)

Mt, Medicago truncatula; Ms, Medicago sativa; Ca, Cicer arietinum; NA, not available; N/A, not applicable

The polymorphic gene-based markers between the parents of mapping population were identified essentially as mentioned in Choi et al. (2004a). Each pair of corresponding sequences from genotypes ICC 4958 and PI 489777 was aligned using Sequencher software (Gene Codes, Ann Arbor, MI, USA) to detect SNPs. The sequences with SNPs were transferred to DNA Strider 1.2 (Douglas 2008) to identify restriction site that is coincident with SNPs and cleavable amplified polymorphic sequence (CAPS) assay for genotyping the corresponding SNPs were developed. In cases where a suitable restriction enzyme site was not identified, oligonucleotide primers were designed immediately adjacent to the SNP position, which allows for a single base extension of the SNP site using ABI SNaPshot Multiplexing Kits (Applied Biosystems Inc., Foster City, CA, USA).

Genotyping assay

For both ICCM as well as H-series SSR markers, the forward primers were anchored with M13 tail (CACGACGTTGTAAAACGAC). PCR amplicons generated by SSR markers were analyzed on capillary electrophoresis, while for gene-based SNP markers the CAPS or SNaPshot assays were used for genotyping. For SSR genotyping, PCR was carried out in 5 μl reaction volume in GeneAmp® PCR System 9700 thermal cycler (Applied Biosystems, Foster City, CA, USA). The reaction mixture contained final concentration of 5 ng/μl of template DNA, 0.5 mM dNTPs, 0.5 μM of M13 tailed forward, 1 μM of reverse primer, 1 μM of M13 labeled primer, 0.75 mM of MgCl2, 0.1 U of Taq DNA polymerase (AmpliTaq Gold), and 1× PCR buffer (AmpliTaq Gold). An initial denaturation was given for 15 min at 94°C. Subsequently, ten touch-down PCR cycles comprising of 94°C for 20 s, 61/60/55°C (depending on the marker as given in Table 2, ESM Table 1) for 20 s, and 72°C for 30 s were performed. These cycles were followed by 35 cycles of 94°C for 10 s with constant annealing temperature of 54/56/48°C (depending on marker and touch-down profiles as given in Table 2, ESM Table 1) for 20 s, and 72°C for 30 s, and a final extension was carried out at 72°C for 20 min. The amplified products were separated by capillary electrophoresis using ABI PRISM® 3700 DNA analyzer, and allele calling was carried out as given in Varshney et al. (2009b).

For SNP genotyping, in CAPS assay, 1.5 μl PCR product of 94 RILs was digested with the corresponding restriction enzymes. Each digestion reaction contained 2–5 U of the corresponding restriction enzyme and 1× compatible buffer in a total volume of 10 μl. Enzyme digestions were incubated at the appropriate temperature for at least 4 h. Digestion products were separated and scored as mentioned in Choi et al. (2004a). In case of SNaPshot assay, the ABI SNaPshot Multiplexing Kits was used following the same protocol as suggested by the manufacturer, except that 0.5 μl SNaPshot mix for a single marker was used (see Choi et al. 2004a).

Polymorphism assessment of SSR markers

While ICCM-series markers were screened on the panel of 48 diverse genotypes including the parents of the inter-specific mapping population (Table 1), the H-series markers were screened on only two parental genotypes (ICC 4958 and PI 489777). Allelic data obtained for the SSR markers were subjected to AlleloBin program (http://www.icrisat.org/gt-bt/download_allelobin.htm) for allele calling based on the repeat units of SSR motif for corresponding markers. In case of ICCM markers, the binned allelic data were used to calculate polymorphic information content (PIC) value of the markers by using the PowerMarker V3.25 program (http://statgen.ncsu.edu/powermarker/).

Linkage analysis and map construction

Genotyping data for both ICCM- and H-series polymorphic markers were generated on 131 recombinant inbred lines (RILs) of the mapping population and for 94 RILs in case of gene-based SNP markers. In addition, marker genotyping data for 407 marker loci were compiled (Huettel et al. 2002; Pfaff and Kahl 2003; Tekeoglu et al. 2000; Winter et al. 1999, 2000).

Marker genotyping data were analyzed using the χ2 test to assess the goodness-of-fit to the expected 1:1 segregation ratio for each marker. Subsequently, genotyping data for all the markers, including those with distorted segregation, were used for linkage analysis using MAPMAKER/EXP 3.0 (Lander et al. 1987). Marker loci were first divided into linkage groups at a LOD score of 16 and a recombination fraction of 0.37 by two-point analysis using the ‘group’ command. Marker order in the linkage groups was determined using the multi-point analysis ‘try’ command of the program. Most likely order of the loci within the group was determined using multipoint ‘compare’ command. The ungrouped marker loci were also attempted to integrate into genetic map at a smaller LOD value (up to 6). The map distances were calculated by applying the ‘Kosambi’ mapping function (Kosambi 1944) as per MAPMAKER/EXP 3.0 program. Residual heterozygosity was not considered in linkage mapping.

Results

Isolation and characterization of simple sequence repeats

A genomic DNA library composed of ca. 400,000 clones was constructed from the ICC 4958 genotype. Hybridization of this library with GA and TAA oligo probes yielded 359 clones that were sequenced and assembled into a set of 115 contig and 342 singleton DNA sequences, which we refer to as genome survey sequences (GSS). These sequences were submitted to National Centre for Biotechnology Information (NCBI) and respective GenBank accessions are mentioned in Table 2.

Two hundred and ninety-nine of the 457 GSSs were determined to contain a total of 643 SSRs, with 165 GSSs containing more than one SSR. As depicted in Fig. 2, di- and tri-nucleotide repeats were the most abundant (39 and 40%, respectively), with mono-nucleotide and tetra-nucleotide repeats representing 16 and 3% of cases, respectively. Other types of SSRs had <1% representation. In terms of repeat motifs, the tri-nucleotide repeat motif TAA/ATT was most common, accounting 36.8% of all repeat, followed by the di-nucleotide repeat GA/CT at 19.2%.
https://static-content.springer.com/image/art%3A10.1007%2Fs00122-010-1265-1/MediaObjects/122_2010_1265_Fig2_HTML.gif
Fig. 2

Frequency of microsatellites based on type of repeat motifs in microsatellite-enriched library of chickpea. Frequency of tri-nucleotide repeats were higher among the chickpea microsatellite markers followed by di-nucleotide repeats. N, mono-nucleotide repeats; NN, di-nucleotide repeats; NNN, tri-nucleotide repeats; NNNN, tetra-nucleotide repeats; NNNNN, penta-nucleotide repeats, NNNNNN, hexa-nucleotide repeats

These SSR loci were categorized into two groups based on the length of their SSR tracts: Class I SSRs (>20 nucleotides in length) and Class II containing SSRs (>12 but <20 nucleotides in length) (Fig. 3). Considering only perfect SSRs, which is the set of SSRs that contain a single motif (e.g., TAA), we observed uneven distribution between Classes I and II. In particular, the longer Class I SSRs were substantially enriched for tri-nucleotide repeats, which represented 77% of all Class I repeats. A similar uneven distribution was noted for other repeats, but most notably the penta-nucleotide repeats, which comprised 55% of all Class II repeats and less than 2% of all Class I repeats.
https://static-content.springer.com/image/art%3A10.1007%2Fs00122-010-1265-1/MediaObjects/122_2010_1265_Fig3_HTML.gif
Fig. 3

Distribution of Class I and Class II repeats in newly isolated chickpea microsatellites. Class I microsatellites are with >20 nucleotides in length and Class II repeats contain perfect SSRs with >12 but <20 nucleotides in length. Among Class I repeats, tri-nucleotide repeats were abundant followed by di-nucleotide repeats, while in Class II repeats, penta-nucleotide repeats contributed highest, followed by hexa-repeats. N, mono-nucleotide repeats; NN, di-nucleotide repeats; NNN, tri-nucleotide repeats; NNNN, tetra-nucleotide repeats; NNNNN, penta-nucleotide repeats, NNNNNN, hexa-nucleotide repeats

Similarity analysis was performed for all 457 GSSs using BLASTN and BLASTX algorithms, and significant similarity was determined at an Expect value threshold of ≤1E–05 (Table 4). Relatively few of the GSS sequences had E values that surpassed this score, irrespective of the species data set under analysis. This is consistent with the expectation that randomly selected short genomic sequences only occasionally correspond to gene coding regions that will match EST data sets. Nevertheless, in cases where BLAST hits with e-value lower than 1E–05 threshold were recorded, the degree of similarity, expressed as either nucleotide identity of deduced protein similarity, was highest for phylogenetically related species, decreasing in rank order of phylogenetic distance (i.e., Medicago > lotus > soybean = cowpea = common bean > poplar > Arabidopsis > rice). Among these sequences, 40 were identified as related sequences in all three analyzed cool season legumes, i.e., chickpea, Medicago, and Lotus (Hologalegina clade; see Fig. 1), while 29 sequences had similarity with all three analyzed warm season legumes, i.e., soybean, common bean, and cowpea (Phaseoleae clade). Only 21 sequences were identified as similar sequences in both Hologalegina and Phaseoleae species. Two of these GSSs (FI856609 and FI856659) showed significant similarity with sequences of all the plant species analyzed in the present study (see ESM Table 2).
Table 4

Functional annotation of ICCM sequences with EST databases

BLAST algorithm

Database

Number of entries in database searched

Number of sequences showing similarity

Number of sequences with significant similarity (<1E–05)

Percentage of sequences with expected values <1E–05

Median expected values

BLASTN

Ca_EST

7,097

450

26

5.69

2E–60

Mt_EST

249,625

449

76

16.63

5E–22

Lj_EST

158,135

449

48

10.50

1E–16

Pv_EST

83,448

449

35

7.66

4E–26

Vu_EST

183,757

440

49

10.72

1E–14

Gm_EST

880,561

440

73

15.97

3E–14

Ah_EST

41,489

227

14

3.06

6E–15

At_EST

1,527,298

444

44

9.63

1E–11

Os_EST

1,220,877

285

20

4.38

2E–19

Pa_EST

418,223

452

48

10.50

1E–12

BLASTX

Uniprot

385,721

409

137

29.98

3E–12

The database were downloaded from NCBI in May–June, 2008

BLASTN, nucleotide BLAST; BLASTX, protein BLAST; EST, expressed sequence tags; Ca, Cicer arietinum; Mt, Medicago truncatula; Lj, Lotus japonicus; Pv, Phaseolus vulgaris; Vu, Vigna unguiculata; Gm, Glycine max; Ah, Arachis hypogaea; At, Arabidopsis thaliana; Os, Oryza sativa; Pa, Populus alba

With the objective of annotating these newly isolated GSSs, all 457 GSSs were analyzed for BLASTX analysis using UniProt database. 137 of these GSSs (29.9%) showed homology to the UniProt database at a relatively relaxed cutoff value of ≤ 1E–05. Among these, 84 unique protein sequences were used for deriving respective gene ontology (GO) (see ESM Table 3). The GO studies permitted assignment of 64 sequences to biological process, 64 to cellular component, and 67 to molecular function ontologies. According to the GO schema, single proteins typically have more than one Ontology assignment.

Development of novel SSR genetic markers

All SSR containing GSSs (299) were analyzed by means of Primer3, yielding a list of potential oligonucleotide primers from which 311 primer pairs were selected and synthesized. Where feasible primer pairs were designed for more than one SSR in a single GSS with the goal of increasing the conversion of GSSs into useable genetic markers.

Primer pairs were screened for amplification of DNA from two chickpea genotypes, i.e., ICC 4958 and ICC 1882 (Table 2). This analysis provided a set of 234 markers (75%) with scorable amplicons. Screening of these 234 markers on 48 genotypes of chickpea further defined a subset of 147 polymorphic markers (62.82%), with allele content ranging from 2 to 21 and an average of five alleles per marker. Among these 147 polymorphic sites, 56 were polymorphic exclusively in wild species, 8 were polymorphic exclusively in cultivated and 83 of them were polymorphic across wild and cultivated species of chickpea.

We refer to these new polymorphic SSR markers as ICCM (ICRISAT Chickpea Microsatellite) markers. Allelic data obtained from 48 genotypes were used to calculate the PIC value of each ICCM marker, and thus infer the discriminatory power of these ICCM markers. PIC values ranged from 0.04 to 0.92 with an average of 0.26. Twenty-six markers displayed the minimum PIC value of 0.04 each, while marker ICCM0160 had both the highest PIC value (0.92) and the highest number of alleles (21), followed by marker ICCM0022 with 18 alleles and a PIC value of 0.89 (Table 2). As has been observed in previous studies of SSRs from plant species (Temnykh et al. 2001), Class I SSRs (41 of 57) were on average more polymorphic that Class II SSRs (106 of 177), with mean PIC values of 0.38 and 0.22, respectively. Nevertheless, a higher fraction of the polymorphic SSRs identified in this study were from Class II (106) compared to Class I (41), owing to the increased abundance of Class II SSRs in our data set. Consistent with their overall abundance in Class I SSRs (Fig. 3), tri-nucleotide repeats (20) constituted major part of the Class I polymorphic sites, with compound repeats (18) comprising the next largest fraction of Class I ICCM markers. In contrast, di-nucleotide repeats were relatively rare in the total Class II data set, but comprised the largest fraction of polymorphic Class II ICCM markers (47); similar to Class I markers, compound repeats (30) constituted of the second most common fraction of Class II polymorphic sites.

In addition to the ICCM markers developed in this study, we also analyzed a set of 233 markers developed primarily by Lichtenzveig et al. (2005); these are the so-called “H-series” SSR markers. One-hundred fifty-three H-series markers yielded scorable amplicons in two PCR profiles (ESM Table 1). Both the ICCM and H-series SSR markers were tested for polymorphism between chickpea ICC 4958 and PI 489777, the parents of the inter-specific mapping population. From this analysis we identified 104 SSRs (52 ICCM and 52 H-series) that were suitable as genetic markers in the inter-specific cross, with polymorphism rates of 33.9 and 22.2% for the H-series and ICCM SSR markers, respectively.

Development of gene-based SNP markers

A set of 246 gene-specific primers, developed earlier by Choi et al. (2004a) based on gene sequences of M. truncatula and M. sativa, were used to amplify DNA of the parental genotypes of the inter-specific mapping population of chickpea. One-hundred four (~42%) of these primer pairs showed strong single fragments on 1% agarose gels; these amplicons were re-sequenced in both mapping parents of the inter-specific cross (ICC 4958 and PI 489777), quality-scored, and trimmed to yield 96 pairs of high quality sequences. Additional 25 primer pairs were designed based on chickpea EST sequences that possessed high similarity to previously mapped Medicago genes, yielding 18 additional high-quality sequence pairs. Alignment of the 114 ICC 4958 and PI 489777 sequence pairs revealed SNPs in 80 (~70%) genes. Seventy-one of these genes contained SNPs that could be converted to reliable genotyping assays using either CAPS or SNaPshot protocols (Table 3). Two additional gene-based markers, P40 and chitinase II, were also used for genetic analysis; these genes were previously mapped in chickpea by Pfaff and Kahl (2003), while their putative orthologs have been mapped in M. truncatula by Choi et al. (2004a).

Construction and features of the genetic map

The inter-specific cross between ICC 4958 × PI 489777 is maintained as an advanced recombinant inbred population that has been used in numerous genetic studies (Huettel et al. 2002; Pfaff and Kahl 2003; Winter et al. 2000). Although the number of markers previously analyzed in this population is relatively large (407 loci), a high percentage of the markers are anonymous sequences (e.g., RFLP) and/or exhibit dominant patterns of inheritance (e.g., AFLP). Thus, in many cases, these legacy genetic maps are based on molecular markers that are either difficult to apply or to reproduce. With the intent of extending this genetic map, and enhancing the number of easily scorable markers, we genotyped the 123 new molecular markers (52 ICCM SSR loci and 71 gene-based SNP loci) and 52 previously published H-series SSR loci described above, and combined the genotype data with that of the 407 previously published loci. Linkage relationships were evaluated using MAPMAKER/EXP 3.0.

As shown in Fig. 4, 47 (90.3%) of 52 ICCM marker loci, 46 (88.4%) of 52 H-series SSR loci, all (100%) of 71 gene-based marker loci, and 357 (87.7%) of 407 legacy marker loci coalesced to yield eight linkage groups, in agreement with eight chickpea chromosomes. The linkage groups were numbered according to Winter et al. (2000), using marker loci that were common to both studies. This revised genetic map contains 521 marker loci, with an average inter-marker distance of 4.99 cM and spanning 2,602.1 cM. Considering the 740-Mbp physical size of the chickpea genome (Arumuganathan and Earle 1991), and ignoring the fact that rates can vary widely within the genome, 1 cM distance in the present map equates to roughly 285 kbp. With the exception of linkage group (LG) 8, which has relatively few genetic markers (25 markers), the average number of markers per linkage group was 71 ± 8.9. LG 8 was also the shortest linkage group based on genetic distance, spanning 124.7 cM; however, in general LG size was not well correlated with the number of markers. As described below, comparative mapping with Medicago truncatula revealed that the entirety of chickpea LG8 corresponds to one arm of Medicago Chr5, adding further credibility to its assignment as a physically short linkage group.
https://static-content.springer.com/image/art%3A10.1007%2Fs00122-010-1265-1/MediaObjects/122_2010_1265_Fig4a_HTML.gif
https://static-content.springer.com/image/art%3A10.1007%2Fs00122-010-1265-1/MediaObjects/122_2010_1265_Fig4b_HTML.gif
Fig. 4

An integrated genetic map of chickpea based on recombinant inbred lines of C. arietinum (ICC 4958) × C. reticulatum (PI 489777). Map was constructed using MAPMAKER/EXP 3.0 with Kosambi mapping function. Distances between the loci (in cM) are shown to the left of the linkage group and all the loci are at the right side of the map. Newly developed SSR markers developed from microsatellite-enriched library (ICCM-series) are bold and italicized; SSR markers taken from Lichtenzveig et al. (2005) are bold, italicized, and underlined; SNP markers which were used as the anchor markers in comparative mapping of chickpea and Medicago were depicted as bold and underlined. Linkage groups (LGs) are designated according to the map of Winter et al. (2000)

Comparative linkage analysis between Medicago and chickpea genomes

As shown in Fig. 5, the 71 gene-based SNP markers are distributed among eight major linkage groups of chickpea, facilitating comparison of genome structure between M. truncatula and chickpea. The respective M. truncatula and chickpea LGs are numbered according to Choi et al. (2004a) and Winter et al. (2000). Alignment of conserved genes between the two genetic maps reveals a high level of synteny between the two genomes. In particular, the M. truncatula linkage groups 1, 2, 3, 4, 7, and 8 correspond to chickpea linkage groups 4, 1, 5, 6, 3, and 7, respectively. Despite the overall high level of synteny between these six pairs of linkage groups, intra-chromosomal segment rearrangements reduce co-linearity (but not synteny) between M. truncatula LG1 (MtLG1) and chickpea LG4 (CaLG4). In contrast to the conserved synteny noted for Mt–Ca linkage group pairs 1–4, 2–1, 3–5, 4–6, 7–3, and 8–7, one-to-one relationships do not hold true for M. truncatula linkage groups 5 and 6 and chickpea linkage groups 2 and 8. In particular, M. truncatula LG5 can be aligned with both chickpea LG2 and LG8. We note that CaLG8 appears to be derived entirely from one arm of MtLG5, consistent with its short genetic distance and small number of genetic markers, described above. In several cases, conserved markers mapped to non-syntenic positions between the two genomes (e.g., CDC2 and TC88727 on MtLG1, DNABP on MtLG4, and TCMO on MtLG5), which may reflect translocation or duplication events involving single genes or small chromosomal segments, or the mapped loci may correspond to paralogous genes. Mt-LG6 could not be effectively aligned to any of the chickpea linkage groups (Fig. 5), consistent previous reports describing Mt LG6 as rich in heterochromatin (Kulikova et al. 2001) and having a relatively low content of transcribed genes (Choi et al. 2004a).
https://static-content.springer.com/image/art%3A10.1007%2Fs00122-010-1265-1/MediaObjects/122_2010_1265_Fig5_HTML.gif
Fig. 5

Comparative map of Medicago and chickpea. Gene-based SNP markers (marked in red color) were used as the anchor markers in comparative analysis of chickpea and Medicago genome. The resistance gene homologs (RGH) are depicted as oval structures and their homologs in Medicago are shown with connecting dotted lines. Solid lines show the macrosynteny observed across chickpea and Medicago with respect to 71 gene-based markers

Comparison of resistance gene homologs (RGH) between Medicago and chickpea

The majority of functionally characterized disease resistance (R) genes encode a nucleotide-binding site (NBS) and a leucine-rich repeat (LRR) region (Hulbert et al. 2001). NBS-LRR genes have been deeply surveyed and characterized in M. truncatula (Zhu et al. 2002; Ameline-Torregrosa et al. 2008), with >330 NBS-LRR genes having known genetic positions. In contrast, chickpea RGHs are not thoroughly surveyed, and only a limited number of sequences from degenerate PCR are available in the public databases (Meyers et al. 1999; Huettel et al. 2002). Nevertheless, several phylogenetically distinct RGH classes have been placed on the genetic map of chickpea (Huettel et al. 2002), thus facilitating the comparative genome analysis presented here.

Comparative phylogenetic analysis of RGH sequences from M. truncatula with those from chickpea is illustrated in Fig. 6. To highlight the comparison, only those M. truncatula sequences that are relevant to the mapped chickpea sequences are shown. In the TIR-NBS-LRR subfamily, chickpea RGH-G (CAC86496 on CaLG6; Huettel et al. 2002) is highly similar to several M. truncatula TIR-NBS-LRR genes located on MtLG4, in a region syntenic to Cicer LG6 that also contains chickpea RGH-G (Huettel et al. 2002). Similarly, chickpea RGH-B (CAC86491; Huettel et al. 2002) is a CC-NBS-LRR gene that is closely related to several CC-NBS-LRR genes located in a cluster at the top of MtLG3, in a region of the Medicago genome syntenic with the terminus of CaLG5 that contains RGH-B (Huettel et al. 2002). A lack of synteny was observed for chickpea RGH-D (TIR-NBS-LRRs represented by sequences CAC86454, CAC86455, CAC86493, AF186626, and AF186629; Huettel et al. 2002), which is located at the top of CaLG2; the closest homologs of RGH-D in M. truncatula (i.e., BAC AC144658) are localized to the distal region of MtLG4. We note that the bottom of CaLG2 harbors numerous active resistance genes against two of the most important diseases of chickpea (Fusarium wilt and Ascochyta blight). At present, no RGHs have been reported mapped close to these resistance phenotypes (Winter et al. 2000; Pfaff and Kahl 2003; Sharma et al. 2004). Moreover, the low frequency of comparative molecular markers around these R gene regions in both M. truncatula and chickpea complicate precise statements regarding the relationship of these genome regions.
https://static-content.springer.com/image/art%3A10.1007%2Fs00122-010-1265-1/MediaObjects/122_2010_1265_Fig6_HTML.gif
Fig. 6

Comparison of RGH sequences in Medicago and chickpea. To highlight the comparison between the chickpea and Medicago RGHs, only those Medicago sequences that are relevant to the mapped chickpea sequences have been shown in this figure. In the TIR-NBS-LRR subfamily, chickpea RGH-G (CAC86496 on Ca-LG6) was found highly similar to several Medicago TIR-NBS-LRR genes (a) located on BAC clones AC144502 and AC135160. AC144502 and AC135160 were closely linked on Mt-LG4, in a region syntenic to Ca-LG6 that also contained chickpea RGH-G. In the CC-NBS-LRR (b) subfamily (Ca-LG5), chickpea RGH-B (CAC86491) was closely related to several CC-NBS-LRR genes located on Medicago BAC clones AC145027, AC142396, AC130810, AC146744, and AC131249

Discussion

SSR markers have become common place for plant genetics and breeding applications. Despite the fact that hundreds of SSR markers have been identified and tested in chickpea (Hüttel et al. 1999; Sethy et al. 2006a, 2006b; Winter et al. 1999; Lichtenzveig et al. 2005), the narrow genetic background of cultivated chickpea germplasm has limited their application, and thus there exists a need to develop a larger set of novel genetic markers. With the objective of enriching the marker repertoire of chickpea, we have contributed novel SSR markers derived from a genomic library enriched for GA and TAA repeat motifs and a set of gene-based SNP markers. The basis of our marker discovery work was C. arietinum genotype ICC 4958, which is being used as a reference genotype for genomic and genetic resource by the chickpea community.

In the present study, 65.4% of hybridizing genomic clones in our SSR-enriched library yielded 643 SSRs. This rate of SSR recovery is comparable with previous studies, for example in peanut where 68% of hybridizing clones yielded SSRs (Cuc et al. 2008). Moreover, the relatively high abundance of tri- and di-nucleotide repeats that we observed is consistent with previous studies in chickpea (Hüttel et al. 1999; Lichtenzveig et al. 2005; Winter et al. 1999). Among the SSRs identified here, the most common SSR motifs were TAA/ATT repeats and GA/CT repeats. This result reflects the fact that our enrichment targeted TAA and GA motifs, and it is consistent with previous studies in chickpea (Hüttel et al. 1999; Lichtenzveig et al. 2005; Winter et al. 1999), other legume species (Akkaya et al. 1992; Cregan et al. 1994; Mun et al. 2006), and even in cereal species (Varshney et al. 2002; Jayashree et al. 2006).

Temnykh et al. (2001) developed a scheme to classify SSRs according to length, in which Class I and Class II SSRs are greater than or less than 20 bp, respectively. This division based on sequence length has practical utility, because Class I SSRs are generally more polymorphic and thus more desirable as genetic markers. The majority of SSRs isolated from our SSR-enriched library belong to Class II, though as expected the Class I SSRs had higher rates of polymorphism. A useful measure of polymorphic potential for any genetic marker is its polymorphism information content value, or PIC value. PIC values provide information on the probability that a given marker will be polymorphic between any two individuals in a population, and thus are a function both of allele frequencies and allele number. Screening of the ICCM-series markers on 48 genotypes revealed that average PIC value of SSR markers having Class I repeats (0.38) was higher than that of Class II repeats (0.22). The majority of the Class I repeats were tri-nucleotide repeats, consistent with the known utility of tri-nucleotide repeats as genetic markers in plants (Varshney et al. 2005).

Polymorphic information content value was also analyzed in relation to repeat unit type and length. Among di-, tri-, and tetra-nucleotide repeats, tri-nucleotide repeats showed higher polymorphism (average PIC = 0.33) with average allele number of 5.7 per marker. Markers with mono-nucleotide repeats showed the least polymorphism (average PIC = 0.197). Relatively longer repeats appear to have contributed to the higher level of polymorphism as compared to di-nucleotide repeats (Gupta and Varshney 2000). It was also observed that among tri-nucleotide SSRs, the SSR markers based on (TAA/TTA) repeat motifs displayed higher polymorphism (average PIC = 0.35) with an average allele number of 6.12 per marker. Similarly, among di-nucleotide repeats SSR markers based on TA/AT repeat motifs had a higher average PIC value (0.27) compared to others with an average of 6.1 alleles. In fact, the earlier studies in chickpea also revealed the abundance of TAA/TTA (tri-nucleotide) and TA/GA (di-nucleotide) SSR motifs and the extensive polymorphism found with markers containing these repeat motifs (Hüttel et al. 1999; Lichtenzveig et al. 2005). PIC values of compound SSRs (average PIC = 0.29) were comparable with tri-nucleotide repeats with 5.68 alleles per marker. This can be attributed to the fact that the markers with compound SSRs have more than one SSR motif, which increases their chances to be polymorphic markers.

We assessed the potential identity of SSR-related sequences by performing BLAST analyses versus plant EST data sets, and based on GeneOntology analysis through UniProt. Less than one-third of the SSR-associated GSS sequences had significant hits in these databases, though were hits were recorded the derived annotations add a potentially useful data type to the marker metadata. Not surprisingly, chickpea GSS sequences (from which the SSRs were derived) had higher similarity to ESTs from other legume species, and overall higher similarity to dicot outgroups (i.e., poplar and Arabidopsis) than to monocot (i.e., rice) data sets.

Comprehensive genetic map of chickpea

An inter-specific mapping population derived from ICC 4958 (C. arietinum) and PI 489777 (C. reticulatum) was used to incorporate novel microsatellite and gene based markers. This mapping population has been widely used in past by chickpea community in order to incorporate several hundred microsatellite markers (Winter et al. 2000) and gene-based markers (Pfaff and Kahl 2003). The diverse genetic background of the parents provides for higher rates of polymorphism not only at the genetic level but also at phenotypic levels such as resistance to Fusarium wilt (Winter et al. 2000) and Ascochyta blight (Rakshit et al. 2003), facilitating trait mapping. Therefore, this population is generally considered as the international reference mapping population.

The present genetic map of chickpea represents 521 marker loci, spanning 2,602 cM with an average inter-marker distance of 4.99 cM. The order of common marker loci defined in present map agrees with earlier reports from Winter et al. (2000). However, the current map differs considerably from that of Winter et al. (2000) in having eight linkage groups, in agreement with eight chromosomes, whereas the Winter et al. (2000) map was composed of 16 linkage groups. There are probably at least two factors that contribute to this condensation of linkage groups: first, the new markers identified in the present study act as bridge points between the Winter et al. linkage groups, and second, essentially all of the markers mapped in the current study behave a co-dominant genetic features, which adds considerable power to the genetic evaluation compared to a high fraction of dominant markers in earlier studies. Importantly, the comparative analyses to Medicago support a simple assignment of eight chickpea linkage groups to eight chromosomes.

Comparative mapping of chickpea and Medicago

Mappig of the gene-based markers from Medicago in the genetic map of chickpea showed not only a high level of macrosynteny but also revealed features of structural divergence between the two genomes. Six of the eight linkage groups display a one-to-one correspondence between the Medicago and chickpea, suggesting that these linkage groups reflect the genome of the common Galegoid clade legume ancestor. Medicago LG5 and LG6, and chickpea LG2 and LG4, appear to have a more complicated ancestry, consisting of a minimum of several chromosomal translocation events. Thus, Mt-LG 5 is essentially a composite of portions of LG2 and LG8 of chickpea. Several research groups have compared genome structure between Medicago and various crop legumes (see Zhu et al. 2005). Our current results extend the comparative network to include chickpea, by demonstrating broad conservation of genome macrostructure between chickpea and Medicago.

One goal of comparative genetic analyses is to transfer information from well-characterized reference species to less well-characterized crops with an eye toward crop improvement. Among the agronomic targets in chickpea is resistance to several economically important pathogens; candidate genes for disease resistance are the conserved family of NBS-LRR resistance gene homologs (RGH). Several phylogenetically distinct RGH classes have been placed on the genetic map of chickpea (Huettel et al. 2002), thus facilitating the comparative genome analysis between chickpea and Medicago. In particular, we have documented two cases of syntenic NBS-LRR clusters that contain co-phyletic genes in each species. Interestingly, Ca-LG2 is known to harbor active resistance genes against Fusarium wilt and Ascochyta blight. At present, no RGHs have been reported mapped close to these resistance phenotypes. Nevertheless, the facts that a single conserved gene (TC87369) maps to the top terminal region of both Mt-LG6 and Ca-LG2, and that both linkage groups are rich in NBS-LRR genes and/or active disease resistance genes (Sharma et al. 2004; Zhu et al. 2002), may suggest shared ancestry of Mt-LG6 and Ca-LG2, though such speculation needs to be verified by more detailed study of the respective genome regions.

Similar observations of NBS-LRR synteny have been made for resistance gene homologs within the Solanaceae (Grube et al.2000) and between Medicago and pea (Pisum sativum) (Zhu et al. 2002). However, the limited numbers of comparative molecular markers (gene-based SNPs) around these R gene regions in both Medicago and chickpea precludes precise statements regarding the relationship of these genome regions. Although the current analysis is based on a relatively small number of comparative markers, the potential of more detailed analyses to predict gene content and chromosomal structure in chickpea by reference to Medicago seems clear.

Conclusion

A set of 311 novel microsatellite markers were developed from microsatellite-enriched library in order to increase the genomic resources in chickpea. In total 147 potential SSR marker loci were found based on diversity pattern of SSR loci on a panel of 48 diverse chickpea genotypes. These markers should have utility for genetic analysis of a range of chickpea mapping populations and as anchor markers in comparative mapping to other legumes.

Acknowledgments

Thanks are due to Prathima Juvvadi, Gudipati Srivani and Abdul Gafoor for their technical assistance. Financial support from Tropical Legume I of Generation Challenge Program (GCP, http://www.generationcp.org) of CGIAR and National Fund of Indian Council of Agricultural Research of Government of India are gratefully acknowledged. The financial support by National Science Foundation Grant 0110206 to DRC is acknowledged. Council of Scientific and Industrial Research (CSIR), Government of India is acknowledged for providing fellowship to SNN and the Indian Council of Research NATP-HRD program for providing fellowship to SD. We thank Dr. Fred Muehlbauer of the USDA-ARS for providing the chickpea recombinant inbred population and genetic marker data.

Open Access

This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.

Supplementary material

122_2010_1265_MOESM1_ESM.xls (32 kb)
Supplementary material 1 (XLS 32 kb)
122_2010_1265_MOESM2_ESM.xls (690 kb)
Supplementary material 2 (XLS 689 kb)
122_2010_1265_MOESM3_ESM.xls (66 kb)
Supplementary material 3 (XLS 66 kb)

Copyright information

© The Author(s) 2010