Plant Molecular Biology

, Volume 29, Issue 4, pp 691–702

Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of α-Amy2 genes

  • Paul J. Rushton
  • Heather Macdonald
  • Alison K. Huttly
  • Colin M. Lazarus
  • Richard Hooley
Research Article

DOI: 10.1007/BF00041160

Cite this article as:
Rushton, P.J., Macdonald, H., Huttly, A.K. et al. Plant Mol Biol (1995) 29: 691. doi:10.1007/BF00041160


The promoters of wheat, barley and wild oat α-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56–58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4–5-C-X22–23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.

Key words

aleuroneAvena fatuaDNA-binding proteinsZinc fingerheterologous expressionleucine zipper

Copyright information

© Kluwer Academic Publishers 1995

Authors and Affiliations

  • Paul J. Rushton
    • 1
  • Heather Macdonald
    • 2
  • Alison K. Huttly
    • 1
  • Colin M. Lazarus
    • 2
  • Richard Hooley
    • 1
  1. 1.IACR-Long Ashton Research Station, Department of Agricultural SciencesUniversity of BristolBristolUK
  2. 2.School of Biological SciencesUniversity of BristolBristolUK
  3. 3.Max-Planck-Institut für ZüchtungsforschungAbteilung BiochemieKöln 30Germany