Expression of Concern: Med Oncol (2015) 32:183 https://doi.org/0.1007/s12032-015-0625-8
Concerns have been raised about this article [1] relating to the appropriateness of the use of the shRNA (5′-GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3′) as a non-targeting control and similarities in text and formatting with other published articles. This is currently under investigation and appropriate editorial action will be taken once the investigation is concluded. The authors did not respond to our correspondence regarding this expression of concern.
Change history
03 May 2019
The original version of this article contained an error in the shRNA sequence. The correct shRNA sequence should read as "TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT".
Reference
Lin Z, Xiong L, Lin Q. Knockdown of eIF3d inhibits cell proliferation through G2/M phase arrest in non-small cell lung cancer. Med Oncol. 2015;32:183.
Author information
Authors and Affiliations
Corresponding author
Additional information
The online version of the original article can be found under https://doi.org/10.1007/s12032-015-0625-8.
Rights and permissions
About this article
Cite this article
Lin, Z., Xiong, L. & Lin, Q. Expression of Concern: Knockdown of eIF3d inhibits cell proliferation through G2/M phase arrest in non-small cell lung cancer. Med Oncol 35, 130 (2018). https://doi.org/10.1007/s12032-018-1178-4
Published:
DOI: https://doi.org/10.1007/s12032-018-1178-4