Erratum to: Cell Mol Neurobiol DOI 10.1007/s10571-014-0126-x

In the original publication of the article, there were errors in primer sequences under the section “Expression Plasmids” and in Table 1. The corrected text and the table have been presented with this erratum.

In the section titled, “Expression Plasmids” the primer sequence “Forward: ccggtgaccgatttctcctggtgttcctcgaggaacaccaggagaaatcggtcatttttg; Reverse: aattcaaaaatgaccgatttctcctggtgttcctcgaggaacaccaggagaaatcggtca” should be read as “Forward: ccggtagcaccatttgaaatcggttactcgagtaaccgatttcaaatggtgctatttttg; Reverse: aattcaaaaatagcaccatttgaaatcggttactcgagtaaccgatttcaaatggtgcta”.

In Table 1, primer sequences were omitted. The corrected table is given below:

Table 1 The primers for real-time PCR
Full size table