Abstract
Tuberculosis caused by Mycobacterium tuberculosis (M. tuberculosis) is the leading cause of death among infectious diseases in the worldwide. Lack of more sensitive and effective diagnostic reagents has increased the awareness of rapid diagnosis for tuberculosis. In this study, T7 phage displayed genomic DNA library of M. tuberculosis was constructed to screen the antigens that specially bind with TB-positive serum from the whole genome of M. tuberculosis and to improve the sensitivity and specificity of tuberculosis serological diagnosis. After three rounds of biopanning, results of DNA sequencing and BLAST analysis showed that 19 positive phages displayed four different proteins and the occurrence frequency of the phage which displayed ribokinase was the highest. The results of indirect ELISA and dot immunoblotting indicated that representative phages could specifically bind to tuberculosis-positive serum. The prokaryotic expression vector containing the DNA sequence of ribokinase gene was then constructed and the recombinant protein was expressed and purified to evaluate the serodiagnosis value of ribokinase. The reactivity of the recombinant ribokinase with different clinical serum was detected and the sensitivities and specificities in tuberculosis serodiagnosis were 90% and 86%, respectively by screening serum from tuberculosis patients (n = 90) and uninfected individuals (n = 90) based on ELISA. Therefore, this study demonstrated that ribokinase had good potential for the serodiagnosis of tuberculosis.
Similar content being viewed by others
Introduction
Tuberculosis (TB), the chronic infectious disease caused by M. tuberculosis remains an important public health problem globally (Xu et al. 2012). The main causes of morbidity and mortality were the emergence of antibiotic resistant strains and HIV coinfection (Krishna et al. 2016; Machado et al. 2018). The World Health Organization claimed that there were about average 8.5 million incident cases and 1.5 million deaths of TB all over the world per year during the past 3 years (You et al. 2017). The lack of rapid and sensitive diagnostic methods leaded to much misdiagnose of TB. Diagnosing and treating latent TB infection is an important strategy to reduce and eliminate the prevalence of TB.
Over the past decades, important progress has been made in controlling the spread of TB. Direct sputum smear microscopy is most commonly used to diagnose active TB. Sputum smear microscopy is simple, fast, and reliable but with poor sensitivity. Sputum sample culture is the gold standard for the diagnosis of TB, which cannot identify individuals with latent TB infection (Deng et al. 2018; Zhou et al. 2015). Traditional tuberculin skin test (TST) is non-specific due to antigen cross-reactivity between M. bovis BCG vaccine strain and environmental mycobacteria (Roupie et al. 2018). Regardless of the advantages of rapidness, sensitivity, and specificity, advanced molecular technique such as PCR is costly and not available everywhere (Theron et al. 2011). However, serological diagnosis is a simple, rapid, and inexpensive, but effective method for in vitro diagnosis of TB and has become a hot topic in TB diagnosis in recent years (Baumann et al. 2014; Yan et al. 2018).
Phage display technology established by Smith GP in 1985 has been widely used in therapeutics, diagnostics, vaccine development, and epitope mapping (Qiang et al. 2017; Wang and Wang 2017). Previous studies demonstrated the potential of page display technology for antigen discovery by identifying M. pneumoniae polypeptides containing B cell epitopes, which recognized by immunoglobulins of infected individuals (Beghetto et al. 2009). This technology has already shown great efficacy in identifying novel antigens from human pathogens such as Toxoplasma gondii (Di Cristina et al. 2004) and Streptococcus pneumoniae (De Paolis et al. 2007). Our previous study also demonstrated that two mimotope peptides screened from phage display peptide library have potential serodiagnosis value for TB (Wang et al. 2016).
In the present study, we reported that ribokinase (RK) was screened from T7 page displayed M. tuberculosis genome DNA library using TB-positive serum primarily purified by saturated ammonium sulfate as the target molecule, and the reactivates of RK with different clinical serum samples were detected. The specificity and sensitivity were analyzed to evaluate the potential serodiagnosis value for TB. Results in this study exhibited that RK screened from T7 phage display M. tuberculosis genome DNA library had good specificity and sensitivity for the serodiagnosis of TB. Thus, RK is a promising antigen for the development of rapid, highly sensitive, and specific serological diagnosis agents of TB.
Materials and methods
Clinical data of patients
A total of 90 TB-positive sera were from patients (age range, 1–85 years old) suffered from TB diagnosed using the sputum smear culture and X-ray inspection, and the antibody to M. tuberculosis were all positive by indirect ELISA and 90 TB-negative sera were from healthy controls (age range, 20–63 years old). The criteria for the healthy control included no TB contact history and BCG vaccination, no clinical signs or symptoms of TB, the sputum smear culture and TST test were negative, normal chest X-ray, and the antibody to M. tuberculosis were negative by indirect ELISA (Luo et al. 2017). All these sera were from the Third People’s Hospital, the specialized TB hospital, of Hengyang City in China. Prior written and informed consent were obtained from every participant and this study was approved by the ethics review board of University of South China.
Construction of the T7 phage displayed M. tuberculosis genomic DNA library
Construction of the T7 phage displayed M. tuberculosis genomic DNA library was performed as previously described by Talwar et al. (2015). The genomic DNA of M. tuberculosis H37Rv was extracted and donated by strain Chinese Center For Disease Control And Prevention (CDC, Beijing, China). The genomic DNA of M. tuberculosis H37Rv was extracted using CTAB (Cetyl trimethyl ammonium bromide) method as described by Yang et al. (2011). The genomic DNA of M. tuberculosis was digested by EcoR I and Hind III and then joined to the T7 10–3b vector using T4 DNA ligase. The library was packaged in vitro using the T7 Select system kit (Novagen,70580–3) as described by manufacturer’s instructions. The recombinant T7 phages were then transformed into BLT5403 to construct the T7 phage displayed genomic DNA library. To evaluate the quality of the library, the titer was determined and the randomness was analyzed using 5′–GGAGCTGTCGTATTCCAGTC–3′ and 5′–AACCCCTCAAGACCCGTTTA–3′ as specific upstream and downstream primers, respectively, to amplify the exogenous DNA sequence of randomly selected 16 phage plaques by PCR.
Biopanning of the T7 phage displayed M. tuberculosis genomic DNA library
The biopanning of the T7 phage displayed M. tuberculosis genomic DNA library was implemented as described by Sakamoto et al. (2016). Briefly, the collected TB-positive serum was preliminary purified by saturated ammonium sulfate precipitation method as described by Wang and Wang (2017). The protein concentration of the purified mixed serum was measured by the quantitative method of Bicinchoninic acid (BCA) protein assay. Three rounds of biological panning were then performed for the constructed T7 phage displayed M. tuberculosis genomic DNA library using the purified mixed TB-positive serum as target molecule. Briefly, for the first round of panning, ELISA plates were coated with 100 μL of purified serum (100 μg/mL) overnight at 4 °C and then blocked for 2 h at 4 °C using 5 mg/mL bovine serum albumin (BSA) in NaHCO3 (0.1 mol/L, pH 8.6). And the plates were then incubated with the amplified phage display peptide library (3.0 × 1011 phages) diluted in 100 μL PBST with slow rotation (60 min at room temperature). After the unbound phages were discarded by washing 6 times with PBST, the bound phage were eluted with 0.2 M Glycine–HCl (pH 2.2) by gentle shaking for 10 min, and then neutralized with 1 M Tris–HCl (pH 9.1). The reverse adsorption was then performed using an empty ELISA plate and negative serum respectively to exclude non-specific binding phages. The basic steps of the second and third round of biopanning were similar to those of the first round except for decreasing target protein concentration to 60 μg/mL, as well as increasing the concentration of Tween 20 to 0.3% in PBST elution and reducing the incubation time to 30 min or prolonging the elution time to 20 min. Finally, the yield of each round of biopanning was calculated based on the output and the input of phages.
DNA sequencing and BLAST analysis
The phages challenged by three cycles of biopanning were expanded and cultured. Then, 19 colonies were randomly selected from the plates with less than 100 plaques and exogenous DNA fragments were amplified by PCR using 5′–GGAGCTGTCGTA TTCCAGTC–3′ and 5′–AACCCCTCAA GACCCGTTTA–3′ as the specific upstream and downstream primers, respectively. The PCR products were analyzed by 1.5% agarose gel electrophoresis and the exogenous DNA sequences displayed by phages were sequenced and then BLAST alignment were performed.
Analysis of the representative phages
The reactivities of representative phages with TB-positive serum was monitored by phage ELISA and Dot immunobinding assay respectively as described by Shi et al. (2018). Briefly, for the phage ELISA, purified TB-positive serum was coated onto an ELISA plate and blocked with 0.5% BSA for 1 h at room temperature. One-microliter purified phages (approximately 1011phages) were added to the plate and incubated for 2 h at ambient temperature. After rinsing with 0.5% PBST for five times, 200 μL of 1:3000 diluted HRP-labeled anti-T7 pIII monoclonal antibody (NEB, Beverly, MA, USA) was added and incubated at 37 °C for 15 min, followed by an additional 6 times washes with PBST. And the color reaction was observed using TMB solution as a substrate for 15 min at 37 °C. The reaction was interrupted by H2SO4 (2 M) and the optical density (OD) values were detected at 450 nm using a microplate reader (Tecan, Infinite F50, Swiss).
For dot immunobinding assay, the small grids were marked on PVDF membrane soaked with methanol. One microliter of each representative phage (approximately 1011 phages) was tested on each grid. The purified TB-positive serum was used as positive control. BSA, TB-negative serum and wild type T7 phage were used as the corresponding controls. The PVDF membrane was then dried at room temperature followed by blocking overnight at 4 °C. The membrane was washed 6 times using PBST. The first antibody (mixed TB-positive serum diluted 1:200 with PBS) was taken to soak the film for 2 h at 37 °C followed by washing 6 times. The samples were incubated with 1:5000 diluted HRP-labeled goat anti-human IgG (Cat #62–8420, Invitrogen, USA) at room temperature for 1 h. The membrane was then rinsed 6 times with PBST. Finally, the color reaction was produced with Electrochemiluminescence (ECL) and measured using a chemiluminescence imaging system.
Expression and purification of RK
According to the results of BLAST analysis, the inserted exogenous DNA sequence (153 bp) for representative phage P1 was 100% homologous with the DNA sequence of the 436–588 of the RK gene. Therefore, the recombinant RK was expressed and purified to further study the potential value of RK in the serodiagnosis of TB. M. tuberculosis genomic DNA extracted using CTAB was used as a template, ATGGATCCCTAGGCCAGCACGGCGA and ATCTCGAGGTGACGATCGCGGTAACCG were used as specific upstream and downstream primers, and Bam HI and Xho I enzyme cleavage site were introduced, respectively. The amplification profile was 94 °C for 10 min, 30 cycles consisting of 94 °C for 50 s, 66 °C for 1 min and 72 °C for 1 min followed by a 72 °C final extension for 10 min. Escherichia coli Rosetta (DE3) and the prokaryotic expression vector pET-28a (Novagen, Madison, WI, USA) were previously conserved in our laboratory. The amplification product was purified and cloned to the prokaryotic expression vector pET–28a (+). And then the recombinant vector pET–28a (+)–RK was transformed into Escherichia coli Rosetta and then the recombinant bacteria was induced with 1 mM isopropyl–β–D–galactopyranoside (IPTG) at 27 °C for 8 h at 180 rpm to express the recombinant protein. The expressed protein was analyzed by 12% agarose gel electrophoresis. In order to purify the recombinant protein, IPTG-induced recombinant bacteria were harvested and lysed and then centrifuged at 13 000 rpm for 30 min. The supernatant was incubated with pre-equilibrated Ni–NTA beads (Qiagen, Inc., Germany) and then washed using buffer A at different pH (8.4, 8.2, 8.0, 7.8, 7.4, 6.3, respectively) and eluted with buffer A (pH 8.2). The protein concentration was detected using bicinchoninic acid protein assay kit (Pierce, Rockford, USA).
Identification of recombinant protein by Western blot
The expressed recombinant protein was boiled for 10 min at 100 °C in SDS-loading buffer. The sample was subjected to SDS-PAGE electrophoresis on 12% acrylamide gel. Protein samples were transferred onto PVDF membranes using semi-dry transfer unit (Bio–Rad, Corning Inc., NY, USA) and the membranes were then blocked at 37 °C water-jacketed incubator for 2 h with 5% (w/v) skim milk diluted in TBST. After being washed three times with TBST, PVDF membranes were incubated for 2 h at 37 °C with mouse anti-His monoclonal antibody (1:500) (CWBIO, CW0082) or mixed TB-positive serum (1:200) diluted in TBST. After being washed, PVDF membranes were incubated at 37 °C for 1 h with HRP-conjugated goat anti-mouse IgG (1:10000) (Abcam, ab6728) or HRP-conjugated anti-human IgG (1:5000) (Abcam, ab6728), respectively. In the end, PVDF membranes was developed with electrochemiluminescence (ECL) using a chemiluminescence imaging system.
ELISA
The indirect ELISA was used to detect the reactivities between the recombinant RK and serum from patients suffered from TB or healthy human according to previous study (Chen et al. 2018). The 96-well plates were coated with 100 μL recombinant RK (10 μg/mL) diluted with 0.1 M carbonate (pH 9.6) per well overnight at 4 °C. The plates were blocked for 2 h at room temperature with 200 μ L 5% (w/v) skim milk diluted in PBST. One hundred microliters of serum samples diluted 1:500 with PBST were added to each well and incubated 2 h at 37 °C followed by three times of washes with PBST. One hundred microliters of HRP-conjugated goat anti-human IgG (Abcam, ab6728) diluted 1:6000 was added to each well and incubated for 1 h at 37 °C. Finally, chromogenic peroxidase substrate and tetramethylbenzidine (TMB) was added to each well and the reaction was stopped after incubation for 15 min at 37 °C in darkness by adding 2 M sulfuric acid. The absorbance was read at 450 nm using a microplate reader (Tecan, Infinite F50, Swiss).
Statistical analysis
GRAPHPAD PRISM 5 software was used to analyze the data. The cut-off values were presented as the geometric mean OD for the TB-negative individual serum samples plus 2 SD (standard deviation). Specificity and sensitivity were calculated according to the following formulas: specificity = number of true negatives/(number of true negatives + number of false positives) and sensitivity = number of true positives/(number of true positive + number of false negatives). Difference was statistically significant at P values < 0.05. The area under the receiver operating characteristic (ROC) curve (AUC) between 0 and 1 indicates the credibility of the ELISA results.
Results
T7 phage displayed M. tuberculosis genomic DNA library was successfully constructed
T7 phage displayed M. tuberculosis genomic DNA library was constructed in order to screen the M. tuberculosis antigens that specifically bind to the TB-positive serum from the whole genome of M. tuberculosis. As shown in Fig. 1a, there were clear bands near the wells, which suggested that M. tuberculosis genomic DNA was successfully extracted. The genomic DNA was mainly shown as a diffuse band after being digested with Eco RI and Hind III (Fig. 1b). Fragmented M. tuberculosis genomic DNA fragments longer than 200 bp were isolated as shown in Fig. 1c. All 16 plaques randomly selected were successfully amplified by PCR (Fig. 1d), which demonstrated the library has high recombination rate. The exogenous DNA fragments inserted into phages were all within the range of 250–2000 bp, which indicated M. tuberculosis genomic DNA library has good randomness. Results of BLAST analysis showed that these inserted sequences were all derived from the genome DNA of M. tuberculosis. Above these results demonstrated that the T7 phage displayed M. tuberculosis genome DNA library was successfully constructed. The titer of the constructed T7 phage display genomic DNA library was about 6 × 106 pfu/cm3.This laid the foundation for the screening of dominant antigens from genome-wide of M. tuberculosis.
The TB-positive serum specific phages were successfully enriched
In order to enrich the phages with good binding specificity to TB-positive serum, three rounds of biopanning were performed for T7 phage displayed genome DNA library of M. tuberculosis. As listed in Table 1, the productivity rate of the first round of biopanning was 2.67 × 10–8, while it reached 3.13 × 10–6 for the third round of biopanning, which demonstrated phage clones bound specifically with TB-positive serum was enriched significantly.
Analysis of the DNA sequences
In order to analyze the foreign DNA fragments inserted into phages, PCR was performed to amplify the exogenous DNA of the enriched phages challenged from the third rounds of biopanning. The corresponding exogenous DNAs of 19 selected randomly phages were successfully amplified by PCR. The results of BLAST analysis showed that there were four different types for exogenous sequences of 19 phages, namely, representative phages P1–P4, which encoded RK, fatty acyl-AMP ligase, cystathionine beta-lyase, and hypothetical protein, respectively. The occurrence frequency of P1 was highest (70%) and the 153 bp DNA sequence inserted P1 phage was 100% homologous with the DNA sequence of the 436–588 of the gene coded RK. The locus tag, protein ID, coded protein, matched sequence range, homology, and repeated times of representative phages were listed in Table 2. Above these results indicated that the four proteins may be TB-positive serum specific binding proteins and RK may be M. tuberculosis dominant antigen challenged from T7 phage displayed whole-genome DNA library of M. tuberculosis.
Representative phages can specifically bind to TB-positive serum
To identify whether representative phages could bind specifically with mixed TB-positive serum, the immunoreactivity of representative phages were assessed by phage ELISA and dot immunobinding assay, respectively. ELISA results showed that the OD value for the four representative phages were significant higher than the negative serum and control group (p < 0.05), which demonstrated these representative phages had good reactivities with TB-positive serum (Fig. 2). For the results of dot immunobinding assay, as shown in the Fig. 3, representative phages and positive control groups showed clear spots, while no spots appeared for the negative control group, which further indicated that these representative phages could bind specifically to the TB-positive serum. Above results demonstrated that RK displayed on the surface of phages can specifically recognize TB-positive serum.
Recombinant RK was successfully expressed and purified
Due to the highest occurrence frequency of the representative phage P1 whose exogenous DNA coded RK, the recombinant RK was expressed and purified in order to evaluate the potential of RK in the serodiagnosis of TB. The target gene was amplified from genomic DNA of M. tuberculosis H37Rv strain and the recombinant prokaryotic vector pET–28a (+)–RK was successfully constructed according to the results of PCR identification (Fig. 4a). As shown in Fig. 4b, the recombinant protein was successfully expressed as His-tagged fusion proteins (36 kDa) and then purified using Ni–nitrilotriacetic acid (NTA) beads. As shown in Fig. 4c, purified RK appeared as a single band via SDS-PAGE analysis. These results indicated that the recombinant RK was successfully expressed and purified.
Identification of recombinant RK by Western blot
To further identify the target protein and verify that RK could react with different clinical serum, Western blot were performed using mice anti-His antibody, mixed TB-positive serum and TB-negative serum, respectively. The results demonstrated that RK could recognize mice anti-His antibody, which showed that this protein is the recombinant fusion protein. And RK could recognize specially the mixed TB-positive serum, but not reacted with TB-negative serum (Fig. 5), which demonstrated that RK had good reactivity with TB-positive serum.
RK had high sensitivities and specificities for serodiagnosis of TB
The sensitivities and specificities of RK for the diagnosis of TB were evaluated by indirect ELISA. As shown in Fig. 6a, the recombinant RK could react with most of the serum from TB-positive patients but with only a few TB-negative serum. And the sensitivity and specificity of RK was 90% and 86%, respectively, which demonstrated RK had high sensitivity and specificity for the serodiagnosis of TB. The statistical analysis including sensitivities, specificities, AUC, cut-off value, and P value were described in Fig. 6b. These data suggested that RK had good potential for the serological diagnosis of TB.
Discussion
TB is a major public health problem worldwide ranking above the human immunodeficiency virus (HIV) infection as the leading cause of deaths from infectious diseases (Osei et al. 2017). Accurate and timely identification for infected individuals is critical to the treatment and control of TB. Rapid and early diagnosis of TB and initiating optimal treatment would reduce numbers of TB cases. The lack of effective, sensitive, and specific diagnostic methods was one of the main problems for the prevention and control of TB. Serological diagnosis was widely used in the early diagnosis of TB because of its simplicity, convenience, low cost, high sensitivity, and specificity (Abebe et al. 2007). So far, many specific antigens of M. tuberculosis have been estimated and used for serological diagnosis. However, the specificity and sensitivity were not ideal. Most researchers have studied the antigenicity of a certain protein by expressing and purifying the protein, which wastes time and its operating is cumbersome. Fortunately, it is promising to screen the dominant antigen specifically binding to TB-positive serum from the M. tuberculosis whole-genome wide of M. tuberculosis by constructing a genomic DNA library and then performing biopanning using TB-positive serum as target molecule.
Phage display technology has been widely used in the field of dominant antigen or epitope screening (Domina et al. 2016), protein–protein interaction, ligand–receptor research, vaccine development, diagnosis, and treatment of cancer because of its advantages such as high-throughput panning and easy purification (Ebrahimizadeh and Rajabibazl 2014). The most commonly used vectors for phage displayed were M13 filamentous phage and T7 phage. As far as the construction of phage displayed genomic DNA library was concerned, T7 phage had obvious advantages as follows: (1) T7 phage is highly stable in various extreme environments such as (high temperature and low pH) (Piggott and Karuso 2016). (2) The life cycle of T7 phage is shorter so that the process of cloning is more rapid than that of M13 phage (Talwar et al. 2016). Various studies have demonstrated the power of T7 phage displayed in many ways. Talwar et al. (2015) developed a T7 phage displayed library to detect sarcoidosis and TB by a panel of novel antigens. San Segundo-Acosta et al. (2018) identified allergenic peptides and mimotopes from olive pollen and mustard seeds using T7 phage displayed library. Cytidine–5–triphosphate synthase1–selective inhibitory peptide from random peptide library displayed on T7 phage was discovered by Sakamoto et al. (2017). The specific M. tuberculosis antigens screened from T7 phage displayed cDNA library may aid to develop a TB vaccine which could generate specific humoral response against M. tuberculosis (Talwar et al. 2016). Talwar H et al. developed a T7 phage cDNA library and constructed a microarray platform using sarcoidosis tissue to develop TB therapeutic or prophylactic vaccines (Talwar et al. 2018). This was different from our study that the potential diagnostic antigen was screened from T7 phage displayed genomic DNA Library of M. tuberculosis.
In this study, four different proteins that could bind specially with TB-positive serum were successfully screened from T7 phage displayed genomic DNA Library of M. tuberculosis. The occurrence frequency of representative phage P1 that displayed exogenous RK was highest. And the results of ELISA and dot immunobinding assay showed that RK had highest binding specificity to the TB-positive serum. Highly specific phage clones could be screened in this study due to the reverse adsorption using TB-negative serum and blank microplate, as well as decreasing target protein concentration, increasing the elution solution concentration, reducing the binding time and prolonging the elution time gradually during the second and third biopanning. For the further studies, RK was successfully expressed and purified and the reactivities of recombinant RK with different clinical serum was detected. ELISA results showed that RK had high specificity and sensitivity in the serodiagnosis of TB.
RK genes have been found in both prokaryotes and eukaryotes, and sequence comparisons have shown that they belong to the PfkB family of carbohydrate kinases, which is also referred to the RK family (Park and Gupta 2008). A RK gene from the anaerobic halothermophilic bacterium Halothermothrix orenii was cloned and overexpressed in E. coli by Kori et al. (2012). Yang Q et al. have characterized the activities of two putative RKs, Rv2436 and Ms4585, from M. tuberculosis and M. smegmatis, respectively (Yang et al.2011). And study proved that RK could physically interact with the mycobacterial topoisomerase I (Top A) both in vivo and in vitro. However, the function and regulation of RKs in M. tuberculosis are still largely unknown.
In a word, our study involved the construction of T7 phage displayed M. tuberculosis genomic DNA library by using T7 phage as a carrier, which was subsequently screened for the dominant M. tuberculosis antigen recognized specially with the TB-positive serum. We assessed RK exhibited high sensitivity (90%) and high specificity (86%) for the detection of M. tuberculosis infection. Our findings demonstrated that RK could be used as a novel perspective antigen for the development of M. tuberculosis diagnostic assays. However, there was a disadvantage due to the limitations of the sample source, that is to say, all TB-positive serum was from patients with active TB. In order to further evaluate the application value of RK in the serodiagnosis of TB, we will further expand serum samples to analyze all samples from patients including non-active TB. For the further studies, we will express and purify the three proteins displayed by the other three representative phages and then evaluate the potential value of these recombinant proteins in the serological diagnosis of TB.
References
Abebe F, Holm-Hansen C, Wiker HG, Bjune G (2007) Progress in serodiagnosis of Mycobacterium tuberculosis infection. Scand J Immunol 66(2-3):176–191
Baumann R, Kaempfer S, Chegou NN, Oehlmann W, Loxton AG, Kaufmann SH, van Helden PD, Black GF, Singh M, Walzl G (2014) Serologic diagnosis of tuberculosis by combining classes against selected mycobacterial targets. J Inf Secur 69:581–589
Beghetto E, De Paolis F, Montagnani F, Cellesi C, Gargano N (2009) Discovery of new Mycoplasma pneumoniae antigens by use of a whole–genome lambda display library. Microbes Infect 11(1):66–73
Chen Y, Cao S, Liu Y, Zhang X, Wang W, Li C (2018) Potential role for Rv2026c- and Rv2421c- specific antibody responses in diagnosing active tuberculosis. Clin Chim Acta 487:369–376
De Paolis F, Beghetto E, Spadoni A, Montagnani F, Felici F, Oggioni MR, Gargano N (2007) Identification of a human immunodominant B–cell epitope within the immunoglobulin A1 protease of Streptococcus pneumoniae. BMC Microbiol 7:113
Deng X, Wang L, You X, Dai P, Zeng Y (2018) Advances in the T7 phage display system (review). Mol Med Rep 17:714–720
Di Cristina M, Del Porto P, Buffolano W, Beghetto E, Spadoni A, Guglietta S, Piccolella E, Felici F, Gargano N (2004) The Toxoplasma gondii bradyzoite antigens BAG1 and MAG1 induce early humoral and cell-mediated immune responses upon human infection. Microbes Infect 6:164–171
Domina M, Lanza Cariccio V, Benfatto S, Venza M, Venza I, Borgogni E, Castellino F, Midiri A, Galbo R, Romeo L, Biondo C, Masignani V, Teti G, Felici F, Beninati C (2016) Functional characterization of a monoclonal antibody epitope using a lambda phage displayed–deep sequencing platform. Sci Rep 6:31458
Ebrahimizadeh W, Rajabibazl M (2014) Bacteriophage vehicles for phage display: biology, mechanism, and application. Curr Microbiol 69:109–120
Kori LD, Hofmann A, Patel BK (2012) Expression, purification, crystallization and preliminary X–ray diffraction analysis of a ribokinase from the thermohalophile Halothermothrix orenii. Acta Crystallogr Sect F Struct Biol Cryst Commun 68:240–243
Krishna P, Jain A, Bisen PS (2016) Microbiome diversity in the sputum of patients with pulmonary tuberculosis. Eur J Clin Microbiol Infect Dis 35:1205–1215
Luo L, Zhu L, Yue J, Liu J, Liu G, Zhang X, Wang H, Xu Y (2017) Antigens Rv0310c and Rv1255c are promising novel biomarkers for the diagnosis of Mycobacterium tuberculosis infection. Emerg Microbes Infect 6:e64
Machado D, Couto I, Viveiros M (2018) A rapid molecular assays for detection of tuberculosis. Pneumonia (Nathan) 10(1):4
Osei E, Der J, Owusu R, Kofie P, Axame WK (2017) The burden of HIV on Tuberculosis patients in the Volta region of Ghana from 2012 to 2015: implication for Tuberculosis control. BMC Infect Dis 17:504
Park J, Gupta RS (2008) Adenosine kinase and ribokinase– the RK family of proteins. Cell Mol Life Sci 65:2875–2896
Piggott AM, Karuso P (2016) Identifying the cellular targets of natural products using T7 phage display. Nat Prod Rep 33:626–636
Qiang X, Sun K, Xing L, Xu Y (2017) Discovery of a polystyrene binding peptide isolated from phage displayed library and its application in peptide immobilization. Sci Rep 7:2673
Roupie V, Alonso-Velasco E, Van Der Heyden S, Holbert S, Duytschaever L, Berthon P, Van Dosselaer I, Van Campe W, Mostin L, Biet F, Roels S, Huygen K, Fretin D (2018) Evaluation of mycobacteria-specific gamma interferon and antibody responses before and after a single intradermal skin test in cattle naturally exposed to M. avium subsp. paratuberculosis and experimentally infected with M. bovis. Vet Immunol Immunopathol 196:35–47
Sakamoto K, Kawata Y, Masuda Y, Umemoto T, Ito T, Asami T, Takekawa S, Ohtaki T, Inooka H (2016) Discovery of an artificial peptide agonist to the fibroblast growth factor receptor 1c/βklotho complex from random peptide T7 phage display. Biochem Biophys Res Commun 480:55–60
Sakamoto K, Ishibashi Y, Adachi R, Matsumoto SI, Oki H, Kamada Y, Sogabe S, Zama Y, Sakamoto JI, Tani A (2017) Identification of cytidine–5–triphosphate synthase1–selective inhibitory peptide from random peptide library displayed on T7 phage. Peptides 94:56–63
San Segundo-Acosta P, Garranzo-Asensio M, Oeo-Santos C, Montero-Calle A, Quiralte J, Cuesta-Herranz J, Villalba M, Barderas R (2018) High–throughput screening of T7 phage display and protein microarrays as a methodological approach for the identification of IgE–reactive components. J Immunol Methods 456:44–53
Shi W, Zhao L, Li S, Xu G, Zeng Y (2018) Serological diagnosis of mycoplasma pneumoniae infection by using the mimic epitopes. World J Microbiol Biotechnol 34:82
Talwar H, Rosati R, Li J, Kissner D, Ghosh S, Madrid FF, Samavati L (2015) Development of a T7 phage display library to detect sarcoidosis and tuberculosis by a panel of novel antigens. Ebio medicine 2:341–350
Talwar H, Talreja J, Samavati L (2016) T7 phage display library a promising strategy to detect tuberculosis specific biomarkers. Mycobact Dis 6:214
Talwar H, Hanoudi SN, Draghici S, Samavati L (2018) Novel T7 phage display library detects classifiers for active Mycobacterium tuberculosis infection. Viruses 10:375
Theron G, Peter J, van Zyl-Smit R, Mishra H, Streicher E, Murray S, Dawson R, Whitelaw A, Hoelscher M, Sharma S, Pai M, Warren R, Dheda K (2011) Evaluation of the Xpert MTB/RIF assay for the diagnosis of pulmonary tuberculosis in a high HIV prevalence setting. Am J Respir Crit Care Med 184:132–172
Wang Y, Wang L (2017) Vaccination with phage–displayed antigenic epitope. Methods Mol Biol 1625:225–235
Wang L, Deng X, Liu H, Zhao L, You X, Dai P, Wan K, Zeng Y (2016) The mimic epitopes of Mycobacterium tuberculosis screened by phage displayed peptide library have serodiagnostic potential for tuberculosis. Pathoge Dis 74. https://doi.org/10.1093/femspd/ftw091
Xu JN, Chen JP, Chen DL (2012) Serodiagnsis efficacy and immunogenicity of the fusion protein of Mycobacterium tuberculosis composed of the 10-kilodalton culture filtrate protein, ESAT-6, and the extracellular domain fragment of PPE68. Clin Vaccine Immunol 19(4):536–580
Yan ZH, Yi L, Wei PJ, Jia HY, Wang J, Wang XJ, Yang B, Gao X, Zhao YL, Zhang HT (2018) Evaluation of panels of Mycobacterium tuberculosis antigens for serodiagnosis of tuberculosis. Int J Tuberc Lung Dis 22(8):959–965
Yang Q, Liu Y, Huang F, He ZG (2011) Physical and functional interaction between D-ribokinase and topoisomerase I has opposite effects on their respective activity in Mycobacterium smegmatis and Mycobacterium tuberculosis. Arch Biochem Biophys 512(2):135–142
You X, Li R, Wan K, Liu L, Xie X, Zhao L, Wu N, Deng X, Wang L, Zeng Y (2017) Evaluation of Rv0220, Rv2958c, Rv2994 and Rv3347c of Mycobacterium tuberculosis for serodiagnosis of tuberculosis. Microb Biotechnol 10:604–611
Zhou F, Xu X, Wu S, Cui X, Fan L, Pan W (2015) Protein array identification of protein markers for serodiagnosis of Mycobacterium tuberculosis infection. Sci Rep 5:15349
Funding
This study was funded by “Prevention and Control of AIDS and Viral Hepatitis etc. Other Major Infectious Disease”—the Science and Technology Major Special Project of the 12th Five-Year Plan of China (grant number 10003006–002) and the National Natural Science Foundation of China (grant number 81871256).
Author information
Authors and Affiliations
Corresponding authors
Ethics declarations
Conflict of interest
The authors declare that they have no conflict of interest.
Ethical statement
The study was approved by the ethics review board of University of South China.
Additional information
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
About this article
Cite this article
Luo, D., Wang, L., Liu, H. et al. Ribokinase screened from T7 phage displayed Mycobacterium tuberculosis genomic DNA library had good potential for the serodiagnosis of tuberculosis. Appl Microbiol Biotechnol 103, 5259–5267 (2019). https://doi.org/10.1007/s00253-019-09756-5
Received:
Revised:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1007/s00253-019-09756-5