Abstract
Determining the timing and molecular repertoire responsible for gene expression is fundamental to understanding a gene’s function. Heritable differences in this character are increasingly regarded as explanatory for complex and common traits. For many known trait-predisposing genes, studies have sought to elucidate the associated logic behind gene regulation. However, there exist many challenges in deciphering these mechanisms. Among them, it is recognized that we have limited understanding of regulatory complexity, the current models of gene regulation have low specificity and any gene’s regulatory logic is dependent on biological context. Addressing these limitations and defining the regulatory genome is an ongoing challenge for molecular biology. We discuss current efforts to define and annotate the regulatory genome by focusing on curation and text-mining activities. We further highlight the type of information and curation process for describing regulatory elements within the ORegAnno database (www.oreganno.org) and how the general standards for such information are changing.
This is a preview of subscription content, log in via an institution to check access.
Access this chapter
Tax calculation will be finalised at checkout
Purchases are for personal use only
References
Khaitovich, P., Hellmann, I., Enard, W. et al. (2005) Parallel patterns of evolution in the genomes and transcriptomes of humans and chimpanzees. Science 309, 1850–1854.
King, M.C., and Wilson, A.C. (1975) Evolution at two levels in humans and chimpanzees. Science 188, 107–116.
Davidson, E.H., and Levine, M.S. (2008) Properties of developmental gene regulatory networks. Proc Natl Acad Sci USA 105, 20063–20066.
Levine, M., and Davidson, E.H. (2005) Gene regulatory networks for development. Proc Natl Acad Sci USA 102, 4936–4942.
Giurumescu, C.A., Sternberg, P.W., and Asthagiri, A.R. (2009) Predicting phenotypic diversity and the underlying quantitative molecular transitions. PLoS Comput Biol 5, e1000354.
Hardy, J., and Singleton, A. (2009) Genomewide association studies and human disease. N Engl J Med 360, 1759–1768.
Waterston, R.H., Lindblad-Toh, K., Birney, E. et al. (2002) Initial sequencing and comparative analysis of the mouse genome. Nature 420, 520–562.
Cooper, G.M., Stone, E.A., Asimenos, G. et al. (2005) Distribution and intensity of constraint in mammalian genomic sequence. Genome Res 15, 901–913.
Birney, E., Stamatoyannopoulos, J.A., Dutta, A. et al. (2007) Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature 447, 799–816.
Attanasio, C., Reymond, A., Humbert, R. et al. (2008) Assaying the regulatory potential of mammalian conserved non-coding sequences in human cells. Genome Biol 9, R168.
Dermitzakis, E.T., and Clark, A.G. (2002) Evolution of transcription factor binding sites in Mammalian gene regulatory regions: conservation and turnover. Mol Biol Evol 19, 1114–1121.
Arnone, M.I., and Davidson, E.H. (1997) The hardwiring of development: organization and function of genomic regulatory systems. Development 124, 1851–1864.
Messina, D.N., Glasscock, J., Gish, W. et al. (2004) An ORFeome-based analysis of human transcription factor genes and the construction of a microarray to interrogate their expression. Genome Res 14, 2041–2047.
Cheung, V.G., Conlin, L.K., Weber, T.M. et al. (2003) Natural variation in human gene expression assessed in lymphoblastoid cells. Nat Genet 33, 422–425.
Frazer, K.A., Ballinger, D.G., Cox, D.R. et al. (2007) A second generation human haplotype map of over 3.1 million SNPs. Nature 449, 851–861.
Monks, S.A., Leonardson, A., Zhu, H. et al. (2004) Genetic inheritance of gene expression in human cell lines. Am J Hum Genet 75, 1094–1105.
Petretto, E., Mangion, J., Dickens, N.J. et al. (2006) Heritability and tissue specificity of expression quantitative trait loci. PLoS Genet 2, e172.
Price, A.L., Patterson, N., Hancks, D.C. et al. (2008) Effects of cis and trans genetic ancestry on gene expression in African Americans. PLoS Genet 4, e1000294.
Schadt, E.E., Monks, S.A., Drake, T.A. et al. (2003) Genetics of gene expression surveyed in maize, mouse and man. Nature 422, 297–302.
Spielman, R.S., Bastone, L.A., Burdick, J.T. et al. (2007) Common genetic variants account for differences in gene expression among ethnic groups. Nat Genet 39, 226–231.
Storey, J.D., Madeoy, J., Strout, J.L. et al. (2007) Gene-expression variation within and among human populations. Am J Hum Genet 80, 502–509.
Stranger, B.E., Nica, A.C., Forrest, M.S. et al. (2007) Population genomics of human gene expression. Nat Genet 39, 1217–1224.
Miao, X., Yu, C., Tan, W. et al. (2003) A functional polymorphism in the matrix metalloproteinase-2 gene promoter (–1306C/T) is associated with risk of development but not metastasis of gastric cardiac adenocarcinoma. Cancer Res 63, 3987–3990.
Bond, G.L., Hu, W., Bond, E.E. et al. (2004) A single nucleotide polymorphism in the MDM2 promoter attenuates the p53 tumor suppressor pathway and accelerates tumor formation in humans. Cell 119, 591–602.
Caspi, A., Sugden, K., Moffitt, T.E. et al. (2003) Influence of life stress on depression: moderation by a polymorphism in the 5-HTT gene. Science 301, 386–389.
Prokunina, L., Castillejo-Lopez, C., Oberg, F. et al. (2002) A regulatory polymorphism in PDCD1 is associated with susceptibility to systemic lupus erythematosus in humans. Nat Genet 32, 666–669.
Kostrikis, L.G., Neumann, A.U., Thomson, B. et al. (1999) A polymorphism in the regulatory region of the CC-chemokine receptor 5 gene influences perinatal transmission of human immunodeficiency virus type 1 to African-American infants. J Virol 73, 10264–10271.
Saito, H., Tada, S., Ebinuma, H. et al. (2001) Interferon regulatory factor 1 promoter polymorphism and response to type 1 interferon. J Cell Biochem 81, 191–200.
Emilsson, V., Thorleifsson, G., Zhang, B. et al. (2008) Genetics of gene expression and its effect on disease. Nature 452, 423–428.
Bryne, J.C., Valen, E., Tang, M.H. et al. (2008) JASPAR, the open access database of transcription factor-binding profiles: new content and tools in the 2008 update. Nucleic Acids Res 36, D102–D106.
Matys, V., Kel-Margoulis, O.V., Fricke, E. et al. (2006) TRANSFAC and its module TRANSCompel: transcriptional gene regulation in eukaryotes. Nucleic Acids Res 34, D108–D110.
Roulet, E., Busso, S., Camargo, A.A. et al. (2002) High-throughput SELEX SAGE method for quantitative modeling of transcription-factor binding sites. Nat Biotechnol 20, 831–835.
Wilson, D., Charoensawan, V., Kummerfeld, S.K. et al. (2008) DBD – taxonomically broad transcription factor predictions: new content and functionality. Nucleic Acids Res 36, D88-D92.
Fulton, D.L., Sundararajan, S., Badis, G. et al. (2009) TFCat: the curated catalog of mouse and human transcription factors. Genome Biol 10, R29.
Lescot, M., Dehais, P., Thijs, G. et al. (2002) PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res 30, 325–327.
Pohar, T.T., Sun, H., and Davuluri, R.V. (2004) HemoPDB: hematopoiesis promoter database, an information resource of transcriptional regulation in blood cell development. Nucleic Acids Res 32, D86–D90.
Grienberg, I., and Benayahu, D. (2005) Osteo-Promoter Database (OPD) – promoter analysis in skeletal cells. BMC Genomics 6, 46.
Schmid, C.D., Perier, R., Praz, V. et al. (2006) EPD in its twentieth year: towards complete promoter coverage of selected model organisms. Nucleic Acids Res 34, D82–D85.
Shahmuradov, I.A., Gammerman, A.J., Hancock, J.M. et al. (2003) PlantProm: a database of plant promoter sequences. Nucleic Acids Res 31, 114–117.
Zhu, J., and Zhang, M.Q. (1999) SCPD: a promoter database of the yeast Saccharomyces cerevisiae. Bioinformatics 15, 607–611.
Kolchanov, N.A., Ignatieva, E.V., Ananko, E.A. et al. (2002) Transcription Regulatory Regions Database. (TRRD): its status in 2002. Nucleic Acids Res 30, 312–317.
Bergman, C.M., Carlson, J.W., and Celniker, S.E. (2005) Drosophila DNase I footprint database: a systematic genome annotation of transcription factor binding sites in the fruitfly, Drosophila melanogaster. Bioinformatics 21, 1747–1749.
Kanamori, M., Konno, H., Osato, N. et al. (2004) A genome-wide and nonredundant mouse transcription factor database. Biochem Biophys Res Commun 322, 787–793.
Tahira, T., Baba, S., Higasa, K. et al. (2005) dbQSNP: a database of SNPs in human promoter regions with allele frequency information determined by single-strand conformation polymorphism-based methods. Hum Mutat 26, 69–77.
Stenson, P.D., Ball, E.V., Mort, M. et al. (2003) Human Gene Mutation Database (HGMD): 2003 update. Hum Mutat 21, 577–581.
Zhao, T., Chang, L.W., McLeod, H.L. et al. (2004) PromoLign: a database for upstream region analysis and SNPs. Hum Mutat 23, 534–539.
Griffith, O.L., Montgomery, S.B., Bernier, B. et al. (2008) ORegAnno: an open-access community-driven resource for regulatory annotation. Nucleic Acids Res 36, D107–D113.
Portales-Casamar, E., Kirov, S., Lim, J. et al. (2007) PAZAR: a framework for collection and dissemination of cis-regulatory sequence annotation. Genome Biol 8, R207.
Aerts, S., Haeussler, M., van Vooren, S. et al. (2008) Text-mining assisted regulatory annotation. Genome Biol 9, R31.
Saric, J., Jensen, L.J., Ouzounova, R. et al. (2006) Extraction of regulatory gene/protein networks from Medline. Bioinformatics 22, 645–650.
Rodriguez-Penagos, C., Salgado, H., Martinez-Flores, I. et al. (2007) Automatic reconstruction of a bacterial regulatory network using Natural Language Processing. BMC Bioinformatics 8, 293.
Beisswanger, E., Lee, V., Kim, J.J. et al. (2008) Gene Regulation Ontology (GRO): design principles and use cases. Stud Health Technol Inform 136, 9–14.
Kelso, J., Visagie, J., Theiler, G. et al. (2003) eVOC: a controlled vocabulary for unifying gene expression data. Genome Res 13, 1222–1230.
Schomburg, I., Chang, A., Ebeling, C. et al. (2004) BRENDA, the enzyme database: updates and major new developments. Nucleic Acids Res 32, D431–D433.
Gallo, S.M., Li, L., Hu, Z. et al. (2006) REDfly: a Regulatory Element Database for Drosophila. Bioinformatics 22, 381–383.
Wasserman, W.W., and Fickett, J.W. (1998) Identification of regulatory regions which confer muscle-specific gene expression. J Mol Biol 278, 167–181.
Ho Sui, S.J., Mortimer, J.R., Arenillas, D.J. et al. (2005) oPOSSUM: identification of over-represented transcription factor binding sites in co-expressed genes. Nucleic Acids Res. 33, 3154–3164.
Blanco, E., Farre, D., Alba, M.M. et al. (2006) ABS: a database of Annotated regulatory Binding Sites from orthologous promoters. Nucleic Acids Res 34, D63–D67.
Jiang, C., Xuan, Z., Zhao, F. et al. (2007) TRED: a transcriptional regulatory element database, new entries and other development. Nucleic Acids Res 35, D137–D140.
Ghosh D. (2000) Object-oriented transcription factors database (ooTFD). Nucleic Acids Res 28, 308–310.
Sierro, N., Kusakabe, T., Park, K.J. et al. (2006) DBTGR: a database of tunicate promoters and their regulatory elements. Nucleic Acids Res 34, D552–D555.
Hubbard T.J., Aken B.L., Ayling S. et al. (2009) Ensembl 2009. Nucleic Acids Res 37, D690–D697.
Sayers E.W., Barrett T., Benson D.A. et al. (2009) Database resources of the National Center for Biotechnology Information. Nucleic Acids Res 37, D5–D15.
Ponomarenko, J.V., Merkulova, T.I., Vasiliev, G.V. et al. (2001) rSNP_Guide, a database system for analysis of transcription factor binding to target sequences: application to SNPs and site-directed mutations. Nucleic Acids Res 29, 312–316.
Trinklein, N.D., Aldred, S.J., Saldanha, A.J. et al. (2003) Identification and functional analysis of human transcriptional promoters. Genome Res 13, 308–312.
King, D.C., Taylor, J., Elnitski, L. et al. (2005) Evaluation of regulatory potential and conservation scores for detecting cis-regulatory modules in aligned mammalian genome sequences. Genome Res 15, 1051–1060.
Wang, H., Zhang, Y., Cheng, Y. et al. (2006) Experimental validation of predicted mammalian erythroid cis-regulatory modules. Genome Res 16, 1480–1492.
Visel, A., Minovitsky, S., Dubchak, I. et al. (2007) VISTA Enhancer Browser – a database of tissue-specific human enhancers. Nucleic Acids Res 35, D88–D92.
Kim T.H., Abdullaev Z.K., Smith A.D. et al. (2007) Analysis of the Vertebrate Insulator Protein CTCF-Binding Sites in the Human Genome. Cell 128, 1231–1245.
Gao, H., Falt, S., Sandelin, A. et al. (2008) Genome-wide identification of estrogen receptor alpha-binding sites in mouse liver. Mol Endocrinol 22, 10–22.
Harbison, C.T., Gordon, D.B., Lee, T.I. et al. (2004) Transcriptional regulatory code of a eukaryotic genome. Nature 431, 99–104.
MacIsaac, K.D., Wang, T., Gordon, D.B. et al. (2006) An improved map of conserved regulatory sites for Saccharomyces cerevisiae. BMC Bioinformatics 7, 113.
Robertson, G., Hirst, M., Bainbridge, M. et al. (2007) Genome-wide profiles of STAT1 DNA association using chromatin immunoprecipitation and massively parallel sequencing. Nat Methods 4, 651–657.
Johnson D.S., Mortazavi A., Myers R.M. et al. (2007) Genome-wide mapping of in vivo protein-DNA interactions. Science 316, 1497–1502.
Lin, C.Y., Vega, V.B., Thomsen, J.S. et al. (2007) Whole-genome cartography of estrogen receptor alpha binding sites. PLoS Genet 3, e87.
Lim, C.A., Yao, F., Wong, J.J. et al. (2007) Genome-wide mapping of RELA(p65) binding identifies E2F1 as a transcriptional activator recruited by NF-kappaB upon TLR4 activation. Mol Cell 27, 622–635.
Wederell, E.D., Bilenky, M., Cullum, R. et al. (2008) Global analysis of in vivo Foxa2-binding sites in mouse adult liver using massively parallel sequencing. Nucleic Acids Res 36, 4549–4564.
Hufton, A.L., Mathia, S., Braun, H. et al. (2009) Deeply conserved chordate non-coding sequences preserve genome synteny but do not drive gene duplicate retention. Genome Res. 19, 2036–2051.
Adryan, B., and Teichmann, S.A. (2006) FlyTF: a systematic review of site-specific transcription factors in the fruit fly Drosophila melanogaster. Bioinformatics 22, 1532–1533.
Zhu, Q.H., Guo, A.Y., Gao, G. et al. (2007) DPTF: a database of poplar transcription factors. Bioinformatics 23, 1307–1308.
Maier, H., Dohr, S., Grote, K. et al. (2005) LitMiner and WikiGene: identifying problem-related key players of gene regulation using publication abstracts. Nucleic Acids Res 33, W779–W782.
Yang, H., Nenadic, G., and Keane, J.A. (2008) Identification of transcription factor contexts in literature using machine learning approaches. BMC Bioinformatics 9 Suppl 3, S11.
Steele, E., Tucker, A., ’t Hoen, P.A. et al. (2009) Literature-based priors for gene regulatory networks. Bioinformatics 25, 1768–1774.
Schilling, T., Schleithoff, E.S., Kairat, A. et al. (2009) Active transcription of the human FAS/CD95/TNFRSF6 gene involves the p53 family. Biochem Biophys Res Commun 387, 399–404.
Kent, W.J. (2002) BLAT – the BLAST-like alignment tool. Genome Res 12, 656–664.
Palaniswamy, S.K., James, S., Sun, H. et al. (2006) AGRIS and AtRegNet. a platform to link cis-regulatory elements and transcription factors into regulatory networks. Plant Physiol 140, 818–829.
Shahi, P., Loukianiouk, S., Bohne-Lang, A. et al. (2006) Argonaute – a database for gene regulation by mammalian microRNAs. Nucleic Acids Res 34, D115–D118.
Barrasa, M.I., Vaglio, P., Cavasino, F. et al. (2007) EDGEdb: a transcription factor-DNA interaction database for the analysis of C. elegans differential gene expression. BMC Genomics 8, 21.
LSPD. (2006) http://rulai.cshl.edu/LSPD/.
Halfon, M.S., Gallo, S.M., and Bergman, C.M. (2008) REDfly 2.0: an integrated database of cis-regulatory modules and transcription factor binding sites in Drosophila. Nucleic Acids Res 36, D594–D598.
Gama-Castro, S., Jimenez-Jacinto, V., Peralta-Gil, M. et al. (2008) RegulonDB (version 6.0): gene regulation model of Escherichia coli K-12 beyond transcription, active (experimental) annotated promoters and Textpresso navigation. Nucleic Acids Res 36, D120–D124.
Wingender, E. (2008) The TRANSFAC project as an example of framework technology that supports the analysis of genomic regulation. Brief Bioinform 9, 326–332.
Author information
Authors and Affiliations
Corresponding author
Editor information
Editors and Affiliations
Appendix 1. ORegAnno XML Sample
Appendix 1. ORegAnno XML Sample
The method for manual annotation detailed in Section 2.4 of the ‘Methods and data’ is recommended for individual low-throughput studies. In some cases, a user may wish to upload a large collection of previously annotated publications, an existing database, or the results of a high-throughput experiment. To allow this, an alternative ‘batch upload’ method is provided. This makes use of the ORegAnno XML template. Data may be converted into an XML format using the following example. Many of the required fields overlap with those explained in Section 2.4. However, each field is also explained in Table 20.2. Please contact the ORegAnno administrators (oreganno@bcgsc.ca) for help with creating and uploading an XML batch file.<?xml version="1.0" encoding="ISO-8859-1"?> <oreganno> <recordSet> <record> <id></id> <stabled></stabled> <type>REGULATORY REGION</type> <outcome>NEGATIVE OUTCOME</outcome> <geneId>ENSDARG00000062484</geneId> <geneName>ptprf</geneName> <geneSource>ENSEMBL</geneSource> <geneVersion>danio_rerio_core_42_6c</geneVersion> <tfId></tfId> <tfName></tfName> <tfSource></tfSource> <tfVersion></tfVersion> <lociName></lociName> <speciesName>Danio rerio</speciesName> <reference>19704032</reference> <date>5-Aug-2009</date> <sequence> <internalSequenceType>sequence</internalSequenceType> <sequence>GGTTAAGAGTGAAAAGAACCAACCTCCTCGAGGGTCTATGAGATGA GGTGAGAGTTTGACCGGGTGATTTAATGGA</sequence> <ensembl_database_name>danio_rerio_core_42_6c</ensembl _database_name> <sequence_region_name>2</sequence_region_name> <start>14342892</start> <end>14342967</end> <strand>1</strand> <verified>true</verified> </sequence> <sequenceWithFlank> <internalSequenceType>sequence_with_flank</internal SequenceType> <sequence>ttgacacagataacaactagcctgaacgaaatataacattgctcttg catctcttttaatgcaggctcatgcaagtcacctgacacaacacattcagcctgaac acaaaggtgaggggcggcataacgcagggagtgggattgata acaagggtctctga ttaaagatggatccaggttggggtctgcaagcggcGGTTAAGAGTGAAAAGAACCAA CCTCCTCGAGGGTCTATGAGATGAGGTGAGAGTTTGACCGGGTGATTTAATGGAgat gaaattgaaagacagagacaaatggaaaacaagagaacatgaaaagacatttgtgaa caatttcatggctgttagaaaaaaaaagaaacacaatggaaatttttaaaagacaga cacaaaagcataacattcacagaaaagtcggatattctaccatatttcatacatatt gcagcaacatccccaatg</sequence> <ensembl_database_name>danio_rerio_core_42_6c</ensembl_ database_name> <sequence_region_name>2</sequence_region_name> <start>14342697</start> <end>14343159</end> <strand>1</strand> <verified>true</verified> </sequenceWithFlank> <searchSpace> <internalSequenceType>searchSpace</internalSequenceType> <sequence>ttgacacagataacaactagcctgaacgaaatataacattgctcttg catctcttttaatgcaggctcatgcaagtcacctgacacaacacattcagcctgaac acaaaggtgaggggcggcataacgcagggagtgggattgataacaagggtctctga ttaaagatggatccaggttggggtctgcaagcggcGGTTAAGAGTGAAAAGAACCAA CCTCCTCGAGGGTCTATGAGATGAGGTGAGAGTTTGACCGGGTGATTTAATGGAgat gaaattgaaagacagagacaaatggaaaacaagagaacatgaaaagacatttgtgaa caatttcatggctgttagaaaaaaaaagaaacacaatggaaatttttaaaagacaga cacaaaagcataacattcacagaaaagtcggatattctaccatatttcatacatatt gcagcaacatccccaatg</sequence> <ensembl_database_name>danio_rerio_core_42_6c</ensembl_ database_name> <sequence_region_name>2</sequence_region_name> <start>14342697</start> <end>14343159</end> <strand>1</strand> <verified>true</verified> </searchSpace> <dataset>OREGDS00016</dataset> <evidenceSet> <evidence> <evidenceClassStableId>OREGEC00001</evidenceClassStableId> <evidenceTypeStableId>OREGET00002</evidenceTypeStableId> <evidenceSubtypeStableId>OREGES00021 </evidenceSubtypeStableId> <comment>Each candidate conserved regulatory region was amplified by PCR and co-injected with an EGFP reporter construct into zebrafish embryos produced from natural matings between the 1-4 cleavage stages. Embryos were then assayed for GFP expressionon the second day of development (approximately 24-16 hpf). The conserved region is recorded here as "sequence," and the entire tested PCR product is recorded as "searchSpace." This element contains the PCNE 67-Dr_ECR7_C2.</comment> <date>5-Aug-2009</date> <userName>hufton</userName> </evidence> </evidenceSet> <commentSet> <comment> <comment>Ancient phylogenetically conserved non-coding elements (PCNEs) were identified around gene families from mouse, zebrafish, fugu, and the invertebrate chordate amphioxus. 42 of these elements were tested for enhancer activity in transgenic zebrafish embryos, including 22 amphioxus elements and 20 fish elements. Results for each of these elements, and 9 randomly chosen negative control elements, are described in this dataset.</comment> <date>5-Aug-2009</date> <userName>hufton</userName> </comment> </commentSet> <scoreSet></scoreSet> <variationSet></variationSet> <metaDataSet></metaDataSet> <deprecatedByDate></deprecatedByDate> <deprecatedByStableID></deprecatedByStableID> <deprecatedByUser></deprecatedByUser> </record> </recordSet> <speciesSet> <species> <name>Danio rerio</name> <taxonId>7955</taxonId> </species> </speciesSet> <userName>hufton</userName> </oreganno>
Rights and permissions
Copyright information
© 2010 Springer Science+Business Media, LLC
About this protocol
Cite this protocol
Montgomery, S.B., Kasaian, K., Jones, S.J., Griffith, O.L. (2010). Annotating the Regulatory Genome. In: Ladunga, I. (eds) Computational Biology of Transcription Factor Binding. Methods in Molecular Biology, vol 674. Humana Press, Totowa, NJ. https://doi.org/10.1007/978-1-60761-854-6_20
Download citation
DOI: https://doi.org/10.1007/978-1-60761-854-6_20
Published:
Publisher Name: Humana Press, Totowa, NJ
Print ISBN: 978-1-60761-853-9
Online ISBN: 978-1-60761-854-6
eBook Packages: Springer Protocols